Transcript: Human NR_147018.1

Homo sapiens actin related protein 3C (ACTR3C), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Homo sapiens (human)
Gene:
ACTR3C (653857)
Length:
8330
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147018.1
NBCI Gene record:
ACTR3C (653857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418383 CGATACGACATGGAATCATTG pLKO_005 577 3UTR 100% 10.800 5.400 Y ACTR3B n/a
2 TRCN0000434511 TCATTGAAGACTGGGATCTTA pLKO_005 592 3UTR 100% 5.625 2.813 Y ACTR3B n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 921 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000136945 CCATGATTCAATTACCTCCCA pLKO.1 1881 3UTR 100% 0.660 0.330 Y DISC1 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 921 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13781 pDONR223 100% 2.9% None (many diffs) n/a
2 ccsbBroad304_13781 pLX_304 0% 2.9% V5 (many diffs) n/a
3 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 2.9% V5 (many diffs) n/a
4 ccsbBroadEn_10792 pDONR223 100% 2.5% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 2.5% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 2.5% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 2.2% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 2.2% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2.2% V5 (many diffs) n/a
10 ccsbBroadEn_15487 pDONR223 0% 1.9% None (many diffs) n/a
11 ccsbBroad304_15487 pLX_304 0% 1.9% V5 (many diffs) n/a
12 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 1.9% V5 (many diffs) n/a
Download CSV