Transcript: Human NR_148036.2

Homo sapiens protein tyrosine kinase 2 (PTK2), transcript variant 64, non-coding RNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
PTK2 (5747)
Length:
5024
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148036.2
NBCI Gene record:
PTK2 (5747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121318 CCGATTGGAAACCAACATATA pLKO.1 2850 3UTR 100% 13.200 18.480 N PTK2 n/a
2 TRCN0000332999 CCGATTGGAAACCAACATATA pLKO_005 2850 3UTR 100% 13.200 18.480 N PTK2 n/a
3 TRCN0000196310 GATGTTGGTTTAAAGCGATTT pLKO.1 877 3UTR 100% 10.800 15.120 N PTK2 n/a
4 TRCN0000344535 GATGTTGGTTTAAAGCGATTT pLKO_005 877 3UTR 100% 10.800 15.120 N PTK2 n/a
5 TRCN0000196667 GCGATTATATGTTAGAGATAG pLKO.1 737 3UTR 100% 10.800 15.120 N PTK2 n/a
6 TRCN0000001620 CCGGTCGAATGATAAGGTGTA pLKO.1 3053 3UTR 100% 4.050 5.670 N PTK2 n/a
7 TRCN0000121211 CTTTGGATTATCCCGATATAT pLKO.1 2094 3UTR 100% 15.000 12.000 N PTK2 n/a
8 TRCN0000194984 CAACAGGTGAAGAGCGATTAT pLKO.1 724 3UTR 100% 13.200 10.560 N PTK2 n/a
9 TRCN0000344599 CAACAGGTGAAGAGCGATTAT pLKO_005 724 3UTR 100% 13.200 10.560 N PTK2 n/a
10 TRCN0000194944 CACACTTTGATTTGGGTTCAT pLKO.1 3620 3UTR 100% 4.950 3.960 N PTK2 n/a
11 TRCN0000121320 GTCTAGAAATACGGCGATCAT pLKO.1 797 3UTR 100% 4.950 3.960 N PTK2 n/a
12 TRCN0000121321 CTTGGCCCTGAGGACATTATT pLKO.1 3173 3UTR 100% 15.000 10.500 N PTK2 n/a
13 TRCN0000195014 CAATATGCTAATCCCACTTTA pLKO.1 3955 3UTR 100% 13.200 9.240 N PTK2 n/a
14 TRCN0000121131 CCTAACCATTGCGGAGAATAT pLKO.1 1278 3UTR 100% 13.200 9.240 N PTK2 n/a
15 TRCN0000121129 GCCCAGGTTTACTGAACTTAA pLKO.1 2400 3UTR 100% 13.200 9.240 N PTK2 n/a
16 TRCN0000344601 GCCCAGGTTTACTGAACTTAA pLKO_005 2400 3UTR 100% 13.200 9.240 N PTK2 n/a
17 TRCN0000196611 GAGATGTACATCAAGGCATTT pLKO.1 1703 3UTR 100% 10.800 7.560 N PTK2 n/a
18 TRCN0000023486 CCAACCTTAATAGAGAAGAAA pLKO.1 974 3UTR 100% 5.625 3.938 N Ptk2 n/a
19 TRCN0000121128 CCAGGGATTATGAGATTCAAA pLKO.1 1637 3UTR 100% 5.625 3.938 N PTK2 n/a
20 TRCN0000023487 CGAGTATTAAAGGTCTTTCAT pLKO.1 382 3UTR 100% 5.625 3.938 N Ptk2 n/a
21 TRCN0000194838 CCTAAGAGTTTACTGGATTCT pLKO.1 901 3UTR 100% 4.950 3.465 N PTK2 n/a
22 TRCN0000121209 CCTCATATTGTGAAGCTGATT pLKO.1 1843 3UTR 100% 4.950 3.465 N PTK2 n/a
23 TRCN0000001618 CGGAGAATATGGCTGACCTAA pLKO.1 1289 3UTR 100% 4.950 3.465 N PTK2 n/a
24 TRCN0000121127 CGTGTGGATATGTGAAGCATT pLKO.1 4061 3UTR 100% 4.950 3.465 N PTK2 n/a
25 TRCN0000121319 GCCCAGAAGAAGGAATCAGTT pLKO.1 1103 3UTR 100% 4.950 3.465 N PTK2 n/a
26 TRCN0000023485 GCCTTAACAATGCGTCAGTTT pLKO.1 1816 3UTR 100% 4.950 3.465 N Ptk2 n/a
27 TRCN0000121130 GCCTTAACAATGCGTCAGTTT pLKO.1 1816 3UTR 100% 4.950 3.465 N PTK2 n/a
28 TRCN0000350696 GCCTTAACAATGCGTCAGTTT pLKO_005 1816 3UTR 100% 4.950 3.465 N Ptk2 n/a
29 TRCN0000195611 CGATGTCATTGACCAAGCAAG pLKO.1 3404 3UTR 100% 4.050 2.835 N PTK2 n/a
30 TRCN0000001621 CGACAGCAACAGGAAATGGAA pLKO.1 2730 3UTR 100% 3.000 2.100 N PTK2 n/a
31 TRCN0000121317 GCAATGTTATTTCTCTTGGAA pLKO.1 4157 3UTR 100% 3.000 2.100 N PTK2 n/a
32 TRCN0000001617 GAGAGCATGAAGCAAAGAATT pLKO.1 3843 3UTR 100% 0.000 0.000 N PTK2 n/a
33 TRCN0000121207 CCCAGGAGAGAATGAAGCAAA pLKO.1 4338 3UTR 100% 4.950 2.970 N PTK2 n/a
34 TRCN0000344602 CCCAGGAGAGAATGAAGCAAA pLKO_005 4338 3UTR 100% 4.950 2.970 N PTK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14818 pDONR223 0% 59.2% None (many diffs) n/a
2 ccsbBroad304_14818 pLX_304 0% 59.2% V5 (many diffs) n/a
3 TRCN0000471115 ACCCGTCAGACGGGGAGAATATCA pLX_317 13% 59.2% V5 (many diffs) n/a
4 TRCN0000489116 AGGTTGAACTATACACTATACCTG pLX_317 12.9% 59.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_13934 pDONR223 100% 37% None (many diffs) n/a
6 ccsbBroad304_13934 pLX_304 0% 37% V5 (many diffs) n/a
7 TRCN0000465393 CCGAGCTAACCTATAGCACCACCA pLX_317 11.8% 37% V5 (many diffs) n/a
Download CSV