Transcript: Human NR_156415.2

Homo sapiens sulfatase 1 (SULF1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SULF1 (23213)
Length:
5519
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_156415.2
NBCI Gene record:
SULF1 (23213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_156415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051101 CGTCGAATTTGAAGGTGAAAT pLKO.1 2310 3UTR 100% 13.200 18.480 N SULF1 n/a
2 TRCN0000051098 CCCAAATATGAACGGGTCAAA pLKO.1 1975 3UTR 100% 4.950 6.930 N SULF1 n/a
3 TRCN0000373588 GCGAGAATGGCTTGGATTAAT pLKO_005 1137 3UTR 100% 15.000 10.500 N SULF1 n/a
4 TRCN0000373589 TCTGGTGGACTGGACTAATTA pLKO_005 3242 3UTR 100% 15.000 10.500 N SULF1 n/a
5 TRCN0000373658 GCCGACCATGGTTACCATATT pLKO_005 1612 3UTR 100% 13.200 9.240 N SULF1 n/a
6 TRCN0000051099 CCAACACATAACTCCTAGTTA pLKO.1 1395 3UTR 100% 5.625 3.938 N SULF1 n/a
7 TRCN0000051100 CCAAGACCTAAGAATCTTGAT pLKO.1 3053 3UTR 100% 0.495 0.347 N SULF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_156415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489880 TATCTAGATAGGGCTCACAGCACC pLX_317 17% 43.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489537 CCCGTCCTGAATGCGCACCTCTTC pLX_317 15% 43.6% V5 1_669del;2953_2954ins143;3140_5519delinsG n/a
3 ccsbBroadEn_11696 pDONR223 100% 31% None (many diffs) n/a
4 ccsbBroad304_11696 pLX_304 0% 31% V5 (many diffs) n/a
5 TRCN0000470613 TTACCGGTAGAGGTGTGCAACAGT pLX_317 22.3% 31% V5 (many diffs) n/a
Download CSV