Transcript: Human NR_158659.1

Homo sapiens TIMM23B-AGAP6 readthrough (TIMM23B-AGAP6), transcript variant 5, long non-coding RNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TIMM23B-AGAP6 (113218477)
Length:
3305
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158659.1
NBCI Gene record:
TIMM23B-AGAP6 (113218477)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262355 ATGGCATGCTCACCTATTATT pLKO_005 1843 3UTR 100% 15.000 7.500 Y AGAP6 n/a
2 TRCN0000153479 CCCTCTCCTCATGCTAATAAA pLKO.1 2091 3UTR 100% 15.000 7.500 Y AGAP4 n/a
3 TRCN0000262358 CGGTGGATCCGTTCCAAATAT pLKO_005 2607 3UTR 100% 15.000 7.500 Y AGAP6 n/a
4 TRCN0000262357 CACAAATTCAGCTAATATTAG pLKO_005 3059 3UTR 100% 13.200 6.600 Y AGAP6 n/a
5 TRCN0000282213 TACAGCTTGTGTTCGACAATA pLKO_005 1338 3UTR 100% 13.200 6.600 Y AGAP6 n/a
6 TRCN0000262356 TGCGCTGGTCCAACCTGTTTA pLKO_005 1657 3UTR 100% 13.200 6.600 Y AGAP6 n/a
7 TRCN0000263044 GAAATCACAAATTCAGCTAAT pLKO_005 3054 3UTR 100% 10.800 5.400 Y AGAP4 n/a
8 TRCN0000263046 TTGGAGATACCTCATCATATC pLKO_005 1419 3UTR 100% 10.800 5.400 Y AGAP4 n/a
9 TRCN0000152204 CAGGAAGGTTATGTCATCTAT pLKO.1 2498 3UTR 100% 5.625 2.813 Y AGAP4 n/a
10 TRCN0000048384 CCTTGGAGATACCTCATCATA pLKO.1 1417 3UTR 100% 5.625 2.813 Y BMS1P1 n/a
11 TRCN0000153941 CCTTGGAGATACCTCATCATA pLKO.1 1417 3UTR 100% 5.625 2.813 Y AGAP4 n/a
12 TRCN0000048327 CCTTCAGACATCTACCATCAA pLKO.1 1910 3UTR 100% 4.950 2.475 Y LOC143158 n/a
13 TRCN0000153940 CCTTCAGACATCTACCATCAA pLKO.1 1910 3UTR 100% 4.950 2.475 Y AGAP4 n/a
14 TRCN0000156808 GAATCCTAAGTGGGCCAGTTT pLKO.1 2369 3UTR 100% 4.950 2.475 Y AGAP4 n/a
15 TRCN0000048402 GTGTATTGAATGCTCAGGTAT pLKO.1 2408 3UTR 100% 4.950 2.475 Y AGAP7P n/a
16 TRCN0000048399 CCGTTCCAAATATGAGGAGAA pLKO.1 2615 3UTR 100% 4.050 2.025 Y AGAP7P n/a
17 TRCN0000154162 CCGTTCCAAATATGAGGAGAA pLKO.1 2615 3UTR 100% 4.050 2.025 Y AGAP4 n/a
18 TRCN0000048403 AGGAAATCACAAATTCAGCTA pLKO.1 3052 3UTR 100% 2.640 1.320 Y AGAP5 n/a
19 TRCN0000154067 CCAACCTGTTTACATCTGAGA pLKO.1 1666 3UTR 100% 2.640 1.320 Y AGAP4 n/a
20 TRCN0000151705 CACAAAGAGATGCAGATAGAT pLKO.1 1441 3UTR 100% 5.625 2.813 Y AGAP4 n/a
21 TRCN0000178920 CCTTCTTTACGATTGGAGGAT pLKO.1 369 3UTR 100% 2.640 1.320 Y TIMM23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02428 pDONR223 100% 16.6% None (many diffs) n/a
2 ccsbBroad304_02428 pLX_304 0% 16.6% V5 (many diffs) n/a
3 ccsbBroadEn_11498 pDONR223 100% 16.5% None (many diffs) n/a
4 ccsbBroad304_11498 pLX_304 0% 16.5% V5 (many diffs) n/a
5 TRCN0000471893 GGGCTAAATTTTAGCTTGGTCAGC pLX_317 74.2% 16.5% V5 (many diffs) n/a
Download CSV