Transcript: Mouse NM_021542.4

Mus musculus potassium channel, subfamily K, member 5 (Kcnk5), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Kcnk5 (16529)
Length:
3364
CDS:
331..1839

Additional Resources:

NCBI RefSeq record:
NM_021542.4
NBCI Gene record:
Kcnk5 (16529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070011 CGAATACAACAAGGCAGATAA pLKO.1 1803 CDS 100% 13.200 18.480 N Kcnk5 n/a
2 TRCN0000317029 CGAATACAACAAGGCAGATAA pLKO_005 1803 CDS 100% 13.200 18.480 N Kcnk5 n/a
3 TRCN0000070012 CACGCCCTATACCGATACTTT pLKO.1 988 CDS 100% 5.625 7.875 N Kcnk5 n/a
4 TRCN0000305516 ACTGGCCCAATGCAATGATTT pLKO_005 581 CDS 100% 13.200 9.240 N Kcnk5 n/a
5 TRCN0000305517 TGGCACCTTTGGTGGTCTATT pLKO_005 1358 CDS 100% 13.200 9.240 N Kcnk5 n/a
6 TRCN0000070008 CCGTCTCATTTCAGAGAGATT pLKO.1 2619 3UTR 100% 4.950 3.465 N Kcnk5 n/a
7 TRCN0000317028 CCGTCTCATTTCAGAGAGATT pLKO_005 2619 3UTR 100% 4.950 3.465 N Kcnk5 n/a
8 TRCN0000070009 CGGGAACCAGACTTTCAACAA pLKO.1 555 CDS 100% 4.950 3.465 N Kcnk5 n/a
9 TRCN0000316947 CGGGAACCAGACTTTCAACAA pLKO_005 555 CDS 100% 4.950 3.465 N Kcnk5 n/a
10 TRCN0000070010 CCTCATCAAACAGATTGGGAA pLKO.1 1239 CDS 100% 2.640 1.848 N Kcnk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01980 pDONR223 100% 84.3% 88.8% None (many diffs) n/a
2 ccsbBroad304_01980 pLX_304 0% 84.3% 88.8% V5 (many diffs) n/a
3 TRCN0000477827 CTCACCGCCTCGTGATCGCTTCTG pLX_317 26% 84.3% 88.8% V5 (many diffs) n/a
Download CSV