Transcript: Mouse NM_144512.2

Mus musculus solute carrier family 6 (neurotransmitter transporter, GABA), member 13 (Slc6a13), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc6a13 (14412)
Length:
2150
CDS:
40..1848

Additional Resources:

NCBI RefSeq record:
NM_144512.2
NBCI Gene record:
Slc6a13 (14412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311347 GCCGCTTCTACGACAACATTG pLKO_005 1460 CDS 100% 10.800 15.120 N Slc6a13 n/a
2 TRCN0000079829 CCCATATCTGAGGTTGCTGAA pLKO.1 1075 CDS 100% 4.050 5.670 N Slc6a13 n/a
3 TRCN0000079828 CCGAATCAATAACATCCCATT pLKO.1 2032 3UTR 100% 4.050 5.670 N Slc6a13 n/a
4 TRCN0000332084 CCGAATCAATAACATCCCATT pLKO_005 2032 3UTR 100% 4.050 5.670 N Slc6a13 n/a
5 TRCN0000079832 CCTCATCCTTATTGTGTCCGT pLKO.1 1293 CDS 100% 0.660 0.924 N Slc6a13 n/a
6 TRCN0000311348 GCCATGGCCTCTTATCAAATA pLKO_005 1500 CDS 100% 13.200 9.240 N Slc6a13 n/a
7 TRCN0000305469 TCCTGTTCTCCCTGATCAAAT pLKO_005 1562 CDS 100% 13.200 9.240 N Slc6a13 n/a
8 TRCN0000305470 ATTCCAGAAGGCCAATGATTC pLKO_005 531 CDS 100% 10.800 7.560 N Slc6a13 n/a
9 TRCN0000079830 GCCAGTTTGTGTGTGTAGAAA pLKO.1 1208 CDS 100% 5.625 3.938 N Slc6a13 n/a
10 TRCN0000079831 GCCACTGACCTACAACAAGAA pLKO.1 1587 CDS 100% 4.950 3.465 N Slc6a13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469635 CTCGCGCCTGGTAACTGACACCCA pLX_317 22.5% 87.9% 90.5% V5 (many diffs) n/a
2 ccsbBroadEn_15594 pDONR223 0% 14% 10.7% None (many diffs) n/a
3 ccsbBroad304_15594 pLX_304 0% 14% 10.7% V5 (many diffs) n/a
Download CSV