Transcript: Mouse NM_001113564.1

Mus musculus serpine1 mRNA binding protein 1 (Serbp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Serbp1 (66870)
Length:
6667
CDS:
119..1324

Additional Resources:

NCBI RefSeq record:
NM_001113564.1
NBCI Gene record:
Serbp1 (66870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102478 CGCTTAAGAAAGAAGGAATAA pLKO.1 417 CDS 100% 13.200 18.480 N Serbp1 n/a
2 TRCN0000158855 GCGCTTAAGAAAGAAGGAATA pLKO.1 416 CDS 100% 10.800 7.560 N SERBP1 n/a
3 TRCN0000292401 GCGCTTAAGAAAGAAGGAATA pLKO_005 416 CDS 100% 10.800 7.560 N SERBP1 n/a
4 TRCN0000102476 CCCGTGAAAGAAGATTTGAAA pLKO.1 516 CDS 100% 5.625 3.938 N Serbp1 n/a
5 TRCN0000102479 GCAGCAGGACTGATAAGTCAA pLKO.1 1251 CDS 100% 4.950 3.465 N Serbp1 n/a
6 TRCN0000102477 GCAGTGATTTGGATCAATCAA pLKO.1 837 CDS 100% 0.563 0.394 N Serbp1 n/a
7 TRCN0000102475 CCCTTTGAGATTGTAGCATAT pLKO.1 2976 3UTR 100% 10.800 6.480 N Serbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02920 pDONR223 100% 93.1% 98.2% None (many diffs) n/a
2 ccsbBroad304_02920 pLX_304 0% 93.1% 98.2% V5 (many diffs) n/a
3 TRCN0000471581 GTTGTGACCCGACCTTTTTGAGCC pLX_317 31.3% 93.1% 98.2% V5 (many diffs) n/a
4 ccsbBroadEn_07992 pDONR223 100% 93% 98% None (many diffs) n/a
5 ccsbBroad304_07992 pLX_304 0% 93% 98% V5 (many diffs) n/a
6 TRCN0000479415 GAAAGACACCAATGTTAGCACCGC pLX_317 29.8% 93% 98% V5 (many diffs) n/a
7 ccsbBroadEn_02921 pDONR223 100% 91.7% 96.8% None (many diffs) n/a
8 ccsbBroad304_02921 pLX_304 0% 91.7% 96.8% V5 (many diffs) n/a
9 TRCN0000469935 CCCATGAGTAGGCCGAAGAGTCGG pLX_317 39.3% 91.7% 96.8% V5 (many diffs) n/a
10 ccsbBroadEn_15781 pDONR223 0% 89.5% 94.7% None (many diffs) n/a
11 ccsbBroad304_15781 pLX_304 0% 89.5% 94.7% V5 (many diffs) n/a
12 TRCN0000471350 CTACCCCCTGCCACTTCGACGGAT pLX_317 44.8% 89.5% 94.7% V5 (many diffs) n/a
Download CSV