Transcript: Mouse NM_022011.4

Mus musculus general transcription factor II H, polypeptide 2 (Gtf2h2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Mus musculus (mouse)
Gene:
Gtf2h2 (23894)
Length:
1707
CDS:
187..1377

Additional Resources:

NCBI RefSeq record:
NM_022011.4
NBCI Gene record:
Gtf2h2 (23894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263116 GGATCACTTAAAGCTACAATA pLKO_005 268 CDS 100% 13.200 18.480 N GTF2H2C n/a
2 TRCN0000374264 GGATCACTTAAAGCTACAATA pLKO_005 268 CDS 100% 13.200 18.480 N Gtf2h2 n/a
3 TRCN0000085832 GCTGTATTCATAAGATCCCAA pLKO.1 1340 CDS 100% 2.640 2.112 N Gtf2h2 n/a
4 TRCN0000085829 CCCAACTCCTTCAGGTATTTA pLKO.1 1356 CDS 100% 15.000 10.500 N Gtf2h2 n/a
5 TRCN0000304596 GAAACCCAAGGAAACATATAA pLKO_005 551 CDS 100% 15.000 10.500 N Gtf2h2 n/a
6 TRCN0000085830 CCATCGCTCTATAATTCCTTA pLKO.1 613 CDS 100% 4.950 3.465 N Gtf2h2 n/a
7 TRCN0000085828 GAAAGCACTTTGAAAGAAGAT pLKO.1 1484 3UTR 100% 4.950 3.465 N Gtf2h2 n/a
8 TRCN0000302046 GAAAGCACTTTGAAAGAAGAT pLKO_005 1484 3UTR 100% 4.950 3.465 N Gtf2h2 n/a
9 TRCN0000374178 ACCTGTGATCCATCTAATATT pLKO_005 712 CDS 100% 15.000 9.000 N Gtf2h2 n/a
10 TRCN0000085831 CATCGCTCTATAATTCCTTAA pLKO.1 614 CDS 100% 10.800 6.480 N Gtf2h2 n/a
11 TRCN0000302109 CATCGCTCTATAATTCCTTAA pLKO_005 614 CDS 100% 10.800 6.480 N Gtf2h2 n/a
12 TRCN0000020966 CCTGGCTGTATTCATAAGATT pLKO.1 1336 CDS 100% 5.625 3.938 N GTF2H2 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1645 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05740 pDONR223 100% 90.4% 96.7% None (many diffs) n/a
2 ccsbBroad304_05740 pLX_304 0% 90.4% 96.7% V5 (many diffs) n/a
3 TRCN0000466876 CCCACCACTCTGTACATCGGTATC pLX_317 32.2% 90.4% 96.7% V5 (many diffs) n/a
4 ccsbBroadEn_15438 pDONR223 0% 37.2% 39.3% None (many diffs) n/a
5 ccsbBroad304_15438 pLX_304 0% 37.2% 39.3% V5 (many diffs) n/a
6 TRCN0000474784 ACGTATCGAGCTAAGCGACCTGAC pLX_317 100% 37.2% 39.3% V5 (many diffs) n/a
Download CSV