Transcript: Mouse NM_008797.3

Mus musculus pyruvate carboxylase (Pcx), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pcx (18563)
Length:
4125
CDS:
125..3661

Additional Resources:

NCBI RefSeq record:
NM_008797.3
NBCI Gene record:
Pcx (18563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112426 CCGAGGTGTAAAGACCAACAT pLKO.1 1480 CDS 100% 4.950 6.930 N Pcx n/a
2 TRCN0000325849 CCGAGGTGTAAAGACCAACAT pLKO_005 1480 CDS 100% 4.950 6.930 N Pcx n/a
3 TRCN0000112427 GCGTCTGGAGTATAAGCCTAT pLKO.1 214 CDS 100% 4.050 5.670 N Pcx n/a
4 TRCN0000325920 GCGTCTGGAGTATAAGCCTAT pLKO_005 214 CDS 100% 4.050 5.670 N Pcx n/a
5 TRCN0000112429 CTTTCGCTCTAAGGTGCTAAA pLKO.1 3010 CDS 100% 10.800 7.560 N Pcx n/a
6 TRCN0000112425 CCCTTCAGCTATTTGTCCTTT pLKO.1 3829 3UTR 100% 4.950 3.465 N Pcx n/a
7 TRCN0000354075 CCCTTCAGCTATTTGTCCTTT pLKO_005 3829 3UTR 100% 4.950 3.465 N Pcx n/a
8 TRCN0000112428 GCACTACTTCATCGAGGTCAA pLKO.1 1081 CDS 100% 4.050 2.835 N Pcx n/a
9 TRCN0000325918 GCACTACTTCATCGAGGTCAA pLKO_005 1081 CDS 100% 4.050 2.835 N Pcx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01147 pDONR223 100% 89.1% 96.7% None (many diffs) n/a
2 ccsbBroad304_01147 pLX_304 0% 89.1% 96.7% V5 (many diffs) n/a
3 TRCN0000473268 GCGCCGCATAGCAAGTTATCCAAT pLX_317 14.6% 89.1% 96.7% V5 (many diffs) n/a
Download CSV