Transcript: Mouse NM_173363.5

Mus musculus eukaryotic translation initiation factor 5 (Eif5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Eif5 (217869)
Length:
3966
CDS:
542..1831

Additional Resources:

NCBI RefSeq record:
NM_173363.5
NBCI Gene record:
Eif5 (217869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173363.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313045 GACGTTGCAAAGGCGCTTAAT pLKO_005 662 CDS 100% 13.200 18.480 N Eif5 n/a
2 TRCN0000338532 GACGTTGCAAAGGCGCTTAAT pLKO_005 662 CDS 100% 13.200 18.480 N EIF5 n/a
3 TRCN0000149550 GCCAAAGAGATTCGTGTCAAA pLKO.1 1637 CDS 100% 4.950 6.930 N EIF5 n/a
4 TRCN0000338404 GCCAAAGAGATTCGTGTCAAA pLKO_005 1637 CDS 100% 4.950 6.930 N EIF5 n/a
5 TRCN0000106264 CCAACGTATCCCACCAAATAT pLKO.1 689 CDS 100% 15.000 12.000 N Eif5 n/a
6 TRCN0000146438 CCAACGTATCCCACCAAATAT pLKO.1 689 CDS 100% 15.000 12.000 N EIF5 n/a
7 TRCN0000338402 CCAACGTATCCCACCAAATAT pLKO_005 689 CDS 100% 15.000 12.000 N EIF5 n/a
8 TRCN0000313047 TTACTGTGAGTGGTCTATAAT pLKO_005 1962 3UTR 100% 15.000 12.000 N Eif5 n/a
9 TRCN0000106263 CGTGTTAACATCCTGTTTGAT pLKO.1 1250 CDS 100% 5.625 4.500 N Eif5 n/a
10 TRCN0000313046 TGGATCTCATGAGGCGAATAA pLKO_005 772 CDS 100% 13.200 9.240 N Eif5 n/a
11 TRCN0000106261 CCACCTGAGAATAGTGACATT pLKO.1 974 CDS 100% 4.950 3.465 N Eif5 n/a
12 TRCN0000312055 CCACCTGAGAATAGTGACATT pLKO_005 974 CDS 100% 4.950 3.465 N Eif5 n/a
13 TRCN0000106262 CCAGTTCTATCGCTACAAGAT pLKO.1 574 CDS 100% 4.950 3.465 N Eif5 n/a
14 TRCN0000146411 CCAGTTCTATCGCTACAAGAT pLKO.1 574 CDS 100% 4.950 3.465 N EIF5 n/a
15 TRCN0000106260 CCTCTAAGAAATATGTCTCAA pLKO.1 1608 CDS 100% 4.950 3.465 N Eif5 n/a
16 TRCN0000312109 CCTCTAAGAAATATGTCTCAA pLKO_005 1608 CDS 100% 4.950 3.465 N Eif5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173363.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06151 pDONR223 100% 92.3% 96.9% None (many diffs) n/a
2 ccsbBroad304_06151 pLX_304 0% 92.3% 96.9% V5 (many diffs) n/a
3 TRCN0000471639 GACATCCACCACTGACTAGTGAGC pLX_317 40.2% 92.3% 96.9% V5 (many diffs) n/a
4 ccsbBroadEn_06152 pDONR223 100% 92.2% 96.7% None (many diffs) n/a
5 ccsbBroad304_06152 pLX_304 0% 92.2% 96.7% V5 (many diffs) n/a
Download CSV