Transcript: Human NM_001220777.1

Homo sapiens cyclin dependent kinase inhibitor 1A (CDKN1A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CDKN1A (1026)
Length:
2119
CDS:
71..565

Additional Resources:

NCBI RefSeq record:
NM_001220777.1
NBCI Gene record:
CDKN1A (1026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001220777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040125 GAGCGATGGAACTTCGACTTT pLKO.1 209 CDS 100% 4.950 6.930 N CDKN1A n/a
2 TRCN0000307347 CCGCGACTGTGATGCGCTAAT pLKO_005 163 CDS 100% 3.600 5.040 N CDKN1A n/a
3 TRCN0000040123 CGCTCTACATCTTCTGCCTTA pLKO.1 616 3UTR 100% 4.050 2.835 N CDKN1A n/a
4 TRCN0000287021 CGCTCTACATCTTCTGCCTTA pLKO_005 616 3UTR 100% 4.050 2.835 N CDKN1A n/a
5 TRCN0000294474 GACAGCAGAGGAAGACCATGT pLKO_005 382 CDS 100% 4.050 2.835 N CDKN1A n/a
6 TRCN0000040127 GTCACTGTCTTGTACCCTTGT pLKO.1 409 CDS 100% 4.050 2.835 N CDKN1A n/a
7 TRCN0000040126 GACAGATTTCTACCACTCCAA pLKO.1 511 CDS 100% 2.640 1.848 N CDKN1A n/a
8 TRCN0000287091 GACAGATTTCTACCACTCCAA pLKO_005 511 CDS 100% 2.640 1.848 N CDKN1A n/a
9 TRCN0000010400 GCTGATCTTCTCCAAGAGGAA pLKO.1 538 CDS 100% 2.640 1.848 N CDKN1A n/a
10 TRCN0000040124 GCTGATCTTCTCCAAGAGGAA pLKO.1 538 CDS 100% 2.640 1.848 N CDKN1A n/a
11 TRCN0000010401 AGAGGTTCCTAAGAGTGCTGG pLKO.1 769 3UTR 100% 2.160 1.512 N CDKN1A n/a
12 TRCN0000294421 GACACCACTGGAGGGTGACTT pLKO_005 238 CDS 100% 1.650 1.155 N CDKN1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001220777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00282 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00282 pLX_304 98.2% 100% 100% V5 n/a
3 TRCN0000471863 CCCTGGGACGAGCCCTTTAGTCAT pLX_317 68.3% 100% 100% V5 n/a
4 ccsbBroadEn_15381 pDONR223 0% 99.7% 99.3% None 93C>A n/a
5 ccsbBroad304_15381 pLX_304 0% 99.7% 99.3% V5 93C>A n/a
6 TRCN0000480114 AACTATTATCAGGCAGATCCTTTC pLX_317 76.1% 99.7% 99.3% V5 93C>A n/a
Download CSV