Transcript: Human NM_001256006.1

Homo sapiens synaptotagmin 14 (SYT14), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
SYT14 (255928)
Length:
5213
CDS:
411..1964

Additional Resources:

NCBI RefSeq record:
NM_001256006.1
NBCI Gene record:
SYT14 (255928)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380545 GAAATTATGCAGTTCGGTTTA pLKO_005 1312 CDS 100% 10.800 15.120 N SYT14 n/a
2 TRCN0000350390 AGATGAAGCGCTGGGTAAATA pLKO_005 572 CDS 100% 15.000 10.500 N SYT14 n/a
3 TRCN0000382274 CACAGACATCCCAACATATAA pLKO_005 1148 CDS 100% 15.000 10.500 N SYT14 n/a
4 TRCN0000002109 CCTTGTTCTTCTACCTATAAA pLKO.1 1199 CDS 100% 15.000 10.500 N SYT14 n/a
5 TRCN0000381969 ACATGGCTCAGTTCCAGAAAT pLKO_005 1532 CDS 100% 13.200 9.240 N SYT14 n/a
6 TRCN0000093198 ACCTTGTTCTTCTACCTATAA pLKO.1 1198 CDS 100% 13.200 9.240 N Syt14 n/a
7 TRCN0000314850 AGTTCTCCAACTCTATCATAA pLKO_005 2420 3UTR 100% 13.200 9.240 N SYT14 n/a
8 TRCN0000314848 CTTGTTCTTCTACCTATAAAG pLKO_005 1200 CDS 100% 13.200 9.240 N SYT14 n/a
9 TRCN0000381956 TCTTTCAAGTGGCCCTATTTC pLKO_005 1759 CDS 100% 13.200 9.240 N SYT14 n/a
10 TRCN0000002105 AGTCCCATTAGAAGAGCTGTT pLKO.1 2035 3UTR 100% 4.050 2.835 N SYT14 n/a
11 TRCN0000002106 CGGTTTAGACTGTATGGTGTA pLKO.1 1326 CDS 100% 4.050 2.835 N SYT14 n/a
12 TRCN0000314849 GGCAGCCAAATCCAGTATATA pLKO_005 1726 CDS 100% 15.000 9.000 N SYT14 n/a
13 TRCN0000002108 CCTTATCCAGAACACACAATT pLKO.1 601 CDS 100% 13.200 7.920 N SYT14 n/a
14 TRCN0000002107 CCTGTGATATTGGAACCTTCT pLKO.1 1428 CDS 100% 4.050 2.430 N SYT14 n/a
15 TRCN0000314847 CCTGTGATATTGGAACCTTCT pLKO_005 1428 CDS 100% 4.050 2.430 N SYT14 n/a
16 TRCN0000147682 GACTATCAGCAGAAGTGATAA pLKO.1 1588 CDS 100% 1.320 0.660 Y SYT14P1 n/a
17 TRCN0000147941 GAGATGTCCAAATGCAAGATA pLKO.1 1692 CDS 100% 5.625 2.813 Y SYT14P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10630 pDONR223 100% 33% 28.4% None (many diffs) n/a
2 ccsbBroad304_10630 pLX_304 0% 33% 28.4% V5 (many diffs) n/a
3 TRCN0000481038 GTGACAGGGAACAATCAAACCCAA pLX_317 71% 33% 28.4% V5 (many diffs) n/a
4 ccsbBroadEn_10376 pDONR223 100% 28% 25.6% None (many diffs) n/a
5 ccsbBroad304_10376 pLX_304 0% 28% 25.6% V5 (many diffs) n/a
6 TRCN0000476481 CTTCGTTGAAACCCAACGGCGATA pLX_317 82.6% 28% 25.6% V5 (many diffs) n/a
Download CSV