Transcript: Mouse XM_006537717.1

PREDICTED: Mus musculus epithelial splicing regulatory protein 1 (Esrp1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Esrp1 (207920)
Length:
3813
CDS:
343..2253

Additional Resources:

NCBI RefSeq record:
XM_006537717.1
NBCI Gene record:
Esrp1 (207920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127337 CCGGTACATTGAGGTTTACAA pLKO.1 1218 CDS 100% 5.625 7.875 N Esrp1 n/a
2 TRCN0000127338 GCTGCCACAATAGAAGACATT pLKO.1 1705 CDS 100% 4.950 6.930 N Esrp1 n/a
3 TRCN0000240875 ACCAAGCCCTCCGACAGTTTA pLKO_005 587 CDS 100% 13.200 10.560 N ESRP1 n/a
4 TRCN0000127335 CGGTACATTGAGGTTTACAAA pLKO.1 1219 CDS 100% 5.625 4.500 N Esrp1 n/a
5 TRCN0000127334 CCACCTGTAAATAAGAAGAAA pLKO.1 2994 3UTR 100% 5.625 3.938 N Esrp1 n/a
6 TRCN0000149820 CTTGCAGCAAGATGGAACTTA pLKO.1 983 CDS 100% 5.625 3.938 N ESRP1 n/a
7 TRCN0000127336 CCTCCCATTATCCCTGTACTA pLKO.1 1621 CDS 100% 4.950 3.465 N Esrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08417 pDONR223 100% 82.9% 87.6% None (many diffs) n/a
2 ccsbBroad304_08417 pLX_304 0% 82.9% 87.6% V5 (many diffs) n/a
3 TRCN0000472693 CAGAGCCGTTCCCTCGTGCTATTA pLX_317 24% 82.9% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_15872 pDONR223 0% 82.2% 87% None (many diffs) n/a
5 ccsbBroad304_15872 pLX_304 0% 82.2% 87% V5 (many diffs) n/a
Download CSV