Transcript: Mouse XM_006510786.1

PREDICTED: Mus musculus branched chain ketoacid dehydrogenase E1, beta polypeptide (Bckdhb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bckdhb (12040)
Length:
1365
CDS:
60..1085

Additional Resources:

NCBI RefSeq record:
XM_006510786.1
NBCI Gene record:
Bckdhb (12040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339110 ATCCAGTTTGCCGACTATATT pLKO_005 345 CDS 100% 15.000 21.000 N Bckdhb n/a
2 TRCN0000339175 TTCGCAAGATGATCAACTATT pLKO_005 1063 CDS 100% 13.200 18.480 N Bckdhb n/a
3 TRCN0000041398 GCAACGAACTGTCATGGATAT pLKO.1 1186 3UTR 100% 10.800 8.640 N Bckdhb n/a
4 TRCN0000374433 CATGACCAGACATGGAAATAT pLKO_005 1108 3UTR 100% 15.000 10.500 N Bckdhb n/a
5 TRCN0000041401 CCAGGGATCAAGGTGGTAATA pLKO.1 528 CDS 100% 13.200 9.240 N Bckdhb n/a
6 TRCN0000339109 GTCATCGATCTGCGGACAATT pLKO_005 807 CDS 100% 13.200 9.240 N Bckdhb n/a
7 TRCN0000374434 TCAACGAAGCTGCCAAGTATC pLKO_005 388 CDS 100% 10.800 7.560 N Bckdhb n/a
8 TRCN0000339112 TCACCGGTGCTACAGCTATTG pLKO_005 319 CDS 100% 10.800 7.560 N Bckdhb n/a
9 TRCN0000041402 CCAGGAAGAATGTTTCTTGAA pLKO.1 941 CDS 100% 4.950 3.465 N Bckdhb n/a
10 TRCN0000041400 CCTCACATCTTTGAGCCCTTT pLKO.1 1008 CDS 100% 4.050 2.835 N Bckdhb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00154 pDONR223 100% 74.2% 79.3% None (many diffs) n/a
2 ccsbBroad304_00154 pLX_304 0% 74.2% 79.3% V5 (many diffs) n/a
3 TRCN0000470199 GCAAAAATGCCGAGCGGATATGCC pLX_317 29.5% 74.2% 79.3% V5 (many diffs) n/a
Download CSV