Transcript: Human NM_001258354.1

Homo sapiens elongation factor Tu GTP binding domain containing 2 (EFTUD2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
EFTUD2 (9343)
Length:
4137
CDS:
262..3150

Additional Resources:

NCBI RefSeq record:
NM_001258354.1
NBCI Gene record:
EFTUD2 (9343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074654 CCCATTATTAAGCCAGTGAAA pLKO.1 535 CDS 100% 4.950 3.960 N EFTUD2 n/a
2 TRCN0000315903 CCCATTATTAAGCCAGTGAAA pLKO_005 535 CDS 100% 4.950 3.960 N EFTUD2 n/a
3 TRCN0000074657 GCCTCTCACAGAACCCATTAT pLKO.1 522 CDS 100% 13.200 9.240 N EFTUD2 n/a
4 TRCN0000315826 GCCTCTCACAGAACCCATTAT pLKO_005 522 CDS 100% 13.200 9.240 N EFTUD2 n/a
5 TRCN0000074655 GCTTTGCTGAAACGCCTAATA pLKO.1 2252 CDS 100% 13.200 9.240 N EFTUD2 n/a
6 TRCN0000315905 GCTTTGCTGAAACGCCTAATA pLKO_005 2252 CDS 100% 13.200 9.240 N EFTUD2 n/a
7 TRCN0000123640 CGCAAGGTCAACAAGAGCTAT pLKO.1 2053 CDS 100% 4.950 3.465 N Eftud2 n/a
8 TRCN0000287154 CGCAAGGTCAACAAGAGCTAT pLKO_005 2053 CDS 100% 4.950 3.465 N Eftud2 n/a
9 TRCN0000074653 CGGGCTCCATTCCCAAGGAAA pLKO.1 3356 3UTR 100% 1.650 1.155 N EFTUD2 n/a
10 TRCN0000315904 CGGGCTCCATTCCCAAGGAAA pLKO_005 3356 3UTR 100% 1.650 1.155 N EFTUD2 n/a
11 TRCN0000074656 CCTGGACAAGAGCATTGTCAT pLKO.1 2964 CDS 100% 0.495 0.347 N EFTUD2 n/a
12 TRCN0000315827 CCTGGACAAGAGCATTGTCAT pLKO_005 2964 CDS 100% 0.495 0.347 N EFTUD2 n/a
13 TRCN0000294566 CAGGATGTTGTGCTCAATTAT pLKO_005 3121 CDS 100% 15.000 10.500 N Eftud2 n/a
14 TRCN0000129405 GATGATGACGACGACGATGAT pLKO.1 373 CDS 100% 4.950 2.475 Y C1orf174 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07395 pDONR223 100% 98.9% 98.8% None 424_425ins30;932G>T n/a
2 ccsbBroad304_07395 pLX_304 0% 98.9% 98.8% V5 424_425ins30;932G>T n/a
3 TRCN0000478794 TCTCAACTAACGGTCAGCTGGAAC pLX_317 12.3% 98.9% 98.8% V5 424_425ins30;932G>T n/a
Download CSV