Transcript: Human NM_001291085.1

Homo sapiens adhesion G protein-coupled receptor A1 (ADGRA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ADGRA1 (84435)
Length:
3700
CDS:
130..1521

Additional Resources:

NCBI RefSeq record:
NM_001291085.1
NBCI Gene record:
ADGRA1 (84435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014520 TGCCACGAACATCAGGAATTA pLKO.1 291 CDS 100% 13.200 9.240 N ADGRA1 n/a
2 TRCN0000358291 TGGGCATCGTGCTGCACTATT pLKO_005 95 5UTR 100% 13.200 9.240 N ADGRA1 n/a
3 TRCN0000358294 CTGCAGAACGAGCACTCATTC pLKO_005 574 CDS 100% 10.800 7.560 N ADGRA1 n/a
4 TRCN0000358290 GACCTTTCCCAGTGTTCAATG pLKO_005 1992 3UTR 100% 10.800 7.560 N ADGRA1 n/a
5 TRCN0000358292 TGCCTTCAGGGCAGAACTAAG pLKO_005 1084 CDS 100% 10.800 7.560 N ADGRA1 n/a
6 TRCN0000014522 CCTGGGACTCTTCGTGCTCAT pLKO.1 729 CDS 100% 1.350 0.945 N ADGRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488241 TCAACTGAGAGATTTCGACATCAA pLX_317 15.4% 82.5% 82.5% V5 (not translated due to prior stop codon) 0_1ins291;207_209delGTA n/a
2 TRCN0000488823 GACCTTTCTCCAAAGGCAAACTAA pLX_317 7.9% 36% 36% V5 (not translated due to prior stop codon) 0_1ins2451;207_209delGTA n/a
3 TRCN0000488645 GTTAGTAATTACTCCAGAGCCAGG pLX_317 7.7% 36% 8.5% V5 (not translated due to prior stop codon) 0_1ins2452;207_209delGTA;1389_1390insG n/a
Download CSV