Transcript: Human XR_243293.1

PREDICTED: Homo sapiens mitogen-activated protein kinase 3 (MAPK3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK3 (5595)
Length:
1927
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243293.1
NBCI Gene record:
MAPK3 (5595)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006151 CGACCTTAAGATTTGTGATTT pLKO.1 634 3UTR 100% 13.200 18.480 N MAPK3 n/a
2 TRCN0000219700 TCATCGGCATCCGAGACATTC pLKO.1 399 3UTR 100% 10.800 15.120 N MAPK3 n/a
3 TRCN0000006152 CTATACCAAGTCCATCGACAT pLKO.1 763 3UTR 100% 4.050 5.670 N MAPK3 n/a
4 TRCN0000219701 CGTGCTCCACCGAGATCTAAA pLKO.1 583 3UTR 100% 13.200 10.560 N MAPK3 n/a
5 TRCN0000234921 ACCTGCTGGACCGGATGTTAA pLKO_005 1014 3UTR 100% 13.200 9.240 N Mapk3 n/a
6 TRCN0000257297 CAACACCACCTGCGACCTTAA pLKO_005 622 3UTR 100% 10.800 7.560 N Mapk3 n/a
7 TRCN0000010998 GCAGCTGAGCAATGACCATAT pLKO.1 508 3UTR 100% 10.800 7.560 N MAPK3 n/a
8 TRCN0000195323 CAACATGAAGGCCCGAAACTA pLKO.1 919 3UTR 100% 5.625 3.938 N MAPK3 n/a
9 TRCN0000006150 CCTGAATTGTATCATCAACAT pLKO.1 904 3UTR 100% 4.950 3.465 N MAPK3 n/a
10 TRCN0000010997 TCCCTGTCAAAGCTGTCACTT pLKO.1 1782 3UTR 100% 4.950 3.465 N MAPK3 n/a
11 TRCN0000199827 GCCACCTCTCTCCTTTGCTGA pLKO.1 1426 3UTR 100% 0.880 0.616 N MAPK3 n/a
12 TRCN0000199498 GACAGACATCTCTGCACCCTG pLKO.1 1245 3UTR 100% 0.720 0.432 N MAPK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488722 TGATGCAACTCCCATTCACCCTGT pLX_317 26.5% 59% V5 (not translated due to prior stop codon) 1_100del;1238_1927del n/a
2 TRCN0000488687 GCTGATGTACGTTCGTCCCGGGCT pLX_317 29.4% 58.9% V5 1_100del;328C>T;1238_1927delinsG n/a
3 TRCN0000488329 TGGGGCGTGGGTCTCATTGTATCG pLX_317 29.6% 58.9% V5 (not translated due to prior stop codon) 1_100del;328C>T;1238_1927del n/a
4 ccsbBroadEn_14800 pDONR223 100% 58.8% None (many diffs) n/a
5 ccsbBroad304_14800 pLX_304 39.5% 58.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000479597 ACAATAAGTATTACTCAAATACAA pLX_317 25.8% 58.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV