Transcript: Human NR_130179.1

Homo sapiens PAGE family member 5 pseudogene (LOC100421746), non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
LOC100421746 (100421746)
Length:
510
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130179.1
NBCI Gene record:
LOC100421746 (100421746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203992 GAACTGGCTCTGCTTAAGATA pLKO.1 293 3UTR 100% 5.625 2.813 Y PAGE2B n/a
2 TRCN0000115701 GCTCTGCTTAAGATAGAGGAT pLKO.1 299 3UTR 100% 2.640 1.320 Y PAGE5 n/a
3 TRCN0000163253 GCTCTGCTTAAGATAGAGGAT pLKO.1 299 3UTR 100% 2.640 1.320 Y PAGE2 n/a
4 TRCN0000161730 CAATCCTCAGAAAGAGGAAAT pLKO.1 101 3UTR 100% 1.080 0.540 Y PAGE2 n/a
5 TRCN0000187285 CCAATCCTCAGAAAGAGGAAA pLKO.1 100 3UTR 100% 0.495 0.248 Y PAGE2B n/a
6 TRCN0000164030 CTCAGAAAGAGGAAATGACCA pLKO.1 106 3UTR 100% 2.640 1.320 Y PAGE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04529 pDONR223 100% 64.5% None (many diffs) n/a
2 ccsbBroad304_04529 pLX_304 0% 64.5% V5 (many diffs) n/a
3 TRCN0000468866 CTTGTTGCCGTGCCGTCGCTGGGA pLX_317 100% 64.5% V5 (many diffs) n/a
4 ccsbBroadEn_05606 pDONR223 100% 61.1% None (many diffs) n/a
5 ccsbBroad304_05606 pLX_304 0% 61.1% V5 (many diffs) n/a
6 ccsbBroadEn_09304 pDONR223 96.8% 61.1% None (many diffs) n/a
7 ccsbBroadEn_05215 pDONR223 100% 59.8% None (many diffs) n/a
8 ccsbBroad304_05215 pLX_304 0% 59.8% V5 (many diffs) n/a
9 TRCN0000469311 GCCGTGCCGTAAACGGACTCCATC pLX_317 100% 59.8% V5 (many diffs) n/a
Download CSV