Transcript: Human XM_011535797.2

PREDICTED: Homo sapiens epithelial cell transforming 2 like (ECT2L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ECT2L (345930)
Length:
3305
CDS:
109..2742

Additional Resources:

NCBI RefSeq record:
XM_011535797.2
NBCI Gene record:
ECT2L (345930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268689 ACTACGTAAGAAGGAGTTATT pLKO_005 486 CDS 100% 13.200 18.480 N ECT2L n/a
2 TRCN0000268693 CTGTACCCATCCCGAAGATTT pLKO_005 2146 CDS 100% 13.200 18.480 N ECT2L n/a
3 TRCN0000268646 ACGCTTCATTTCTCTATATAT pLKO_005 147 CDS 100% 15.000 10.500 N ECT2L n/a
4 TRCN0000268647 GGCACAGAGCATCGGAATATT pLKO_005 912 CDS 100% 15.000 10.500 N ECT2L n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3211 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3212 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05500 pDONR223 100% 88.2% 88.2% None 0_1ins207;1372_1497del n/a
2 ccsbBroad304_05500 pLX_304 0% 88.2% 88.2% V5 0_1ins207;1372_1497del n/a
3 TRCN0000476145 AGCCGGTTCGCAAAATTCCTTCCC pLX_317 14.5% 88.2% 88.2% V5 0_1ins207;1372_1497del n/a
Download CSV