Transcript: Human XM_017005409.1

PREDICTED: Homo sapiens acylphosphatase 2 (ACYP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACYP2 (98)
Length:
2279
CDS:
521..1183

Additional Resources:

NCBI RefSeq record:
XM_017005409.1
NBCI Gene record:
ACYP2 (98)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051162 TGCTTCAGAATGTATACAGAA pLKO.1 710 CDS 100% 4.950 3.465 N ACYP2 n/a
2 TRCN0000051159 TGGGTGAAGAATACCAGCAAA pLKO.1 761 CDS 100% 4.950 3.465 N ACYP2 n/a
3 TRCN0000299074 TGGGTGAAGAATACCAGCAAA pLKO_005 761 CDS 100% 4.950 3.465 N ACYP2 n/a
4 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 908 CDS 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00022 pDONR223 100% 35.4% 21.4% None (many diffs) n/a
2 ccsbBroad304_00022 pLX_304 0% 35.4% 21.4% V5 (many diffs) n/a
3 TRCN0000468242 CAGTAAACTCTCTAACCCTGTTCC pLX_317 100% 35.4% 21.4% V5 (many diffs) n/a
4 TRCN0000489881 TCTTCAAACTGACCCGGTAAGATC pLX_317 100% 35.4% 21.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV