Transcript: Human XR_001754199.1

PREDICTED: Homo sapiens family with sequence similarity 209 member A (FAM209A), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM209A (200232)
Length:
951
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754199.1
NBCI Gene record:
FAM209A (200232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283723 CCAAAGTGCGGAATCTTAAAC pLKO_005 428 3UTR 100% 13.200 9.240 N FAM209A n/a
2 TRCN0000268504 TCGAGGTGGAGCTTATGAAAT pLKO_005 401 3UTR 100% 13.200 9.240 N FAM209A n/a
3 TRCN0000172604 GTGTCCAAAGTGCGGAATCTT pLKO.1 424 3UTR 100% 5.625 3.938 N FAM209A n/a
4 TRCN0000283724 GTGCAATACGGAGAGCACTTT pLKO_005 151 3UTR 100% 4.950 3.465 N FAM209A n/a
5 TRCN0000268563 AGTAACCTCAGGCTTCGAAAG pLKO_005 472 3UTR 100% 6.000 3.600 N FAM209A n/a
6 TRCN0000268505 AGCAAATGGCTCTGGCTTCTT pLKO_005 217 3UTR 100% 4.950 2.970 N FAM209A n/a
7 TRCN0000167490 GCTTATGAAATTTGTGTCCAA pLKO.1 411 3UTR 100% 2.640 1.584 N FAM209A n/a
8 TRCN0000172679 GCTGTTGTGCCGTTTGTGATA pLKO.1 898 3UTR 100% 4.950 2.475 Y FAM209B n/a
9 TRCN0000168414 GTTCTCTTCTCTGAGACAGAA pLKO.1 108 3UTR 100% 4.950 2.475 Y FAM209A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05185 pDONR223 100% 53.9% None 1_45del;559_951del n/a
2 ccsbBroad304_05185 pLX_304 0% 53.9% V5 1_45del;559_951del n/a
3 TRCN0000481061 CTTAGTCTTCATCCTCGTCTTATT pLX_317 75.3% 53.9% V5 1_45del;559_951del n/a
4 ccsbBroadEn_13649 pDONR223 100% 30.3% None (many diffs) n/a
5 ccsbBroad304_13649 pLX_304 0% 30.3% V5 (many diffs) n/a
6 TRCN0000465475 AAGCAACCACGATGACCGTACCTA pLX_317 100% 30.3% V5 (many diffs) n/a
Download CSV