Transcript: Human XM_011535656.2

PREDICTED: Homo sapiens fyn related Src family tyrosine kinase (FRK), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRK (2444)
Length:
2805
CDS:
244..1422

Additional Resources:

NCBI RefSeq record:
XM_011535656.2
NBCI Gene record:
FRK (2444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356027 CCTCGTTGGTGAACATAATAT pLKO_005 984 CDS 100% 15.000 21.000 N FRK n/a
2 TRCN0000231475 CCCGAAGCCATTCGTAGTAAT pLKO_005 1108 CDS 100% 13.200 18.480 N FRK n/a
3 TRCN0000195487 CCTAAGGAACGACCTACATTT pLKO.1 1324 CDS 100% 13.200 18.480 N FRK n/a
4 TRCN0000195605 CCAGGTTCAATGGATCCAAAT pLKO.1 700 CDS 100% 10.800 15.120 N FRK n/a
5 TRCN0000010095 GCTCCATTTGATTTGTCGTAT pLKO.1 547 CDS 100% 4.950 6.930 N FRK n/a
6 TRCN0000194652 CCTGACATATTCAAGTGATAG pLKO.1 1520 3UTR 100% 10.800 8.640 N FRK n/a
7 TRCN0000010097 CGAAATAAAGCTGCCGGTGAA pLKO.1 1077 CDS 100% 4.050 3.240 N FRK n/a
8 TRCN0000355976 AGGACAGTCAAGGTGATATAT pLKO_005 1605 3UTR 100% 15.000 10.500 N FRK n/a
9 TRCN0000231473 CCATTTGATTTGTCGTATAAA pLKO_005 550 CDS 100% 15.000 10.500 N FRK n/a
10 TRCN0000231474 TGAATCTAGACACGAAATAAA pLKO_005 1065 CDS 100% 15.000 10.500 N FRK n/a
11 TRCN0000378239 AGCACACTAAACCAAGTTATT pLKO_005 1652 3UTR 100% 13.200 9.240 N FRK n/a
12 TRCN0000219689 TGATTGTACTTGGAGTAATTG pLKO.1 1956 3UTR 100% 13.200 9.240 N FRK n/a
13 TRCN0000231476 TGATTGTACTTGGAGTAATTG pLKO_005 1956 3UTR 100% 13.200 9.240 N FRK n/a
14 TRCN0000010096 CAGTTTGGCGAAGTATGGGAA pLKO.1 634 CDS 100% 2.640 1.848 N FRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00590 pDONR223 100% 77.5% 77.2% None 0_1ins338;2delT;5_6insCC n/a
2 ccsbBroad304_00590 pLX_304 0% 77.5% 77.2% V5 0_1ins338;2delT;5_6insCC n/a
3 TRCN0000467336 AGGATTCAGGGTCCTTTCTATAGG pLX_317 29.1% 77.5% 77.2% V5 0_1ins338;2delT;5_6insCC n/a
4 ccsbBroadEn_14647 pDONR223 0% 77.5% 77.2% None 0_1ins338;2delT;5_6insCC n/a
5 ccsbBroad304_14647 pLX_304 0% 77.5% 77.2% V5 0_1ins338;2delT;5_6insCC n/a
6 TRCN0000481127 AATGGACTAATAGTCCTTCCAAAG pLX_317 30.8% 77.5% 77.2% V5 0_1ins338;2delT;5_6insCC n/a
7 TRCN0000492174 ATGCAGAACATGCAAACTCACTCT pLX_317 27.7% 77.5% 77.2% V5 (not translated due to prior stop codon) 0_1ins338;2delT;5_6insCC n/a
Download CSV