Transcript: Human XM_017027111.1

PREDICTED: Homo sapiens CUGBP Elav-like family member 5 (CELF5), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELF5 (60680)
Length:
3451
CDS:
338..1378

Additional Resources:

NCBI RefSeq record:
XM_017027111.1
NBCI Gene record:
CELF5 (60680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074429 CGGCAATATCATTTCCTCCAA pLKO.1 1189 CDS 100% 2.640 3.696 N CELF5 n/a
2 TRCN0000422174 ACTTTGGGTTGACTCGGTTTG pLKO_005 3255 3UTR 100% 6.000 4.800 N CELF5 n/a
3 TRCN0000418320 TGGTGTTCCTGTTACGTGTTT pLKO_005 3315 3UTR 100% 4.950 3.960 N CELF5 n/a
4 TRCN0000436666 ATTTCTGCTACGAGTAATTTC pLKO_005 3160 3UTR 100% 13.200 9.240 N CELF5 n/a
5 TRCN0000074430 CGGCTTCGTGAGCTTTGATAA pLKO.1 1249 CDS 100% 13.200 9.240 N CELF5 n/a
6 TRCN0000420531 AGGCTGTGCTTTCGTGAAGTT pLKO_005 442 CDS 100% 4.950 3.465 N CELF5 n/a
7 TRCN0000074428 CGTGATTTGTACAATGTACTT pLKO.1 3138 3UTR 100% 4.950 3.465 N CELF5 n/a
8 TRCN0000424040 ATGCAACAGCAGACAACAGTC pLKO_005 674 CDS 100% 4.050 2.835 N CELF5 n/a
9 TRCN0000074432 TCCTCCAAGGTGTTTATGGAT pLKO.1 1202 CDS 100% 3.000 2.100 N CELF5 n/a
10 TRCN0000433706 AGTCCAGCAGTACACAGCCAT pLKO_005 1006 CDS 100% 2.640 1.848 N CELF5 n/a
11 TRCN0000429984 AGTTTGGAGACACGGAGCTGA pLKO_005 1149 CDS 100% 2.640 1.848 N CELF5 n/a
12 TRCN0000424182 AGCTACCAACCAGAGCAAGTG pLKO_005 1225 CDS 100% 4.050 2.430 N CELF5 n/a
13 TRCN0000247429 AGCAGTACACAGCCATGTATC pLKO_005 1011 CDS 100% 10.800 7.560 N Celf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08804 pDONR223 100% 71.3% 71.3% None 0_1ins417 n/a
2 ccsbBroad304_08804 pLX_304 0% 71.3% 71.3% V5 0_1ins417 n/a
3 TRCN0000470282 TAGTGTCAACTCCATCTTCCCAAA pLX_317 21.8% 71.3% 71.3% V5 0_1ins417 n/a
4 ccsbBroadEn_14239 pDONR223 100% 54% 40.6% None (many diffs) n/a
5 ccsbBroad304_14239 pLX_304 0% 54% 40.6% V5 (many diffs) n/a
6 TRCN0000465239 CTTAGCCTAGCTGATTATTTGTTA pLX_317 26.8% 54% 40.6% V5 (many diffs) n/a
Download CSV