Transcript: Mouse XM_006541130.3

PREDICTED: Mus musculus leucine rich repeat containing 28 (Lrrc28), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc28 (67867)
Length:
2816
CDS:
224..1120

Additional Resources:

NCBI RefSeq record:
XM_006541130.3
NBCI Gene record:
Lrrc28 (67867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541130.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179606 GCAGTACGTGTATGTGGATAA pLKO.1 631 CDS 100% 10.800 15.120 N Lrrc28 n/a
2 TRCN0000179285 GCGTCATCTTCGATTAGCTAA pLKO.1 562 CDS 100% 4.950 6.930 N Lrrc28 n/a
3 TRCN0000216071 CTCTGTTTACTGGTATGATTT pLKO.1 2163 3UTR 100% 13.200 9.240 N Lrrc28 n/a
4 TRCN0000216651 CAATGCCTTAGAGATCGTTTG pLKO.1 514 CDS 100% 6.000 4.200 N Lrrc28 n/a
5 TRCN0000183474 GTACGTGTATGTGGATAACAA pLKO.1 634 CDS 100% 5.625 3.938 N Lrrc28 n/a
6 TRCN0000179820 CCCATGTTTACCTTCGTCTAT pLKO.1 977 CDS 100% 4.950 3.465 N Lrrc28 n/a
7 TRCN0000195923 CCTCTGGAAACTTCCTGTCTT pLKO.1 1707 3UTR 100% 4.950 3.465 N Lrrc28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541130.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04772 pDONR223 100% 70.3% 73.2% None (many diffs) n/a
2 ccsbBroad304_04772 pLX_304 0% 70.3% 73.2% V5 (many diffs) n/a
3 TRCN0000466194 TCCCGTCAACCGGTGAGCTGGTCA pLX_317 35.2% 70.3% 73.2% V5 (many diffs) n/a
4 ccsbBroadEn_13098 pDONR223 100% 27.4% 23.9% None (many diffs) n/a
5 ccsbBroad304_13098 pLX_304 0% 27.4% 23.9% V5 (many diffs) n/a
6 TRCN0000468959 TCCTAGGGACCACCATATTTTTAG pLX_317 100% 27.4% 23.9% V5 (many diffs) n/a
Download CSV