Transcript: Mouse XM_006497310.2

PREDICTED: Mus musculus ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (Atp5c1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp5c1 (11949)
Length:
1137
CDS:
116..1009

Additional Resources:

NCBI RefSeq record:
XM_006497310.2
NBCI Gene record:
Atp5c1 (11949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043449 GCATACTTTATAGGACTCATT pLKO.1 531 CDS 100% 4.950 6.930 N ATP5F1C n/a
2 TRCN0000290957 GCATACTTTATAGGACTCATT pLKO_005 531 CDS 100% 4.950 6.930 N ATP5F1C n/a
3 TRCN0000306018 TGAAGCCTGCCCGAGTGTATG pLKO_005 303 CDS 100% 3.600 2.880 N Atp5c1 n/a
4 TRCN0000306016 GTGTATGGGACAGGTTCTTTG pLKO_005 317 CDS 100% 10.800 7.560 N Atp5c1 n/a
5 TRCN0000306017 AGGTTCTTTGGCTCTGTATGA pLKO_005 328 CDS 100% 4.950 3.465 N Atp5c1 n/a
6 TRCN0000076219 GACAAGAAGAAGCACCTCATT pLKO.1 374 CDS 100% 4.950 3.465 N Atp5c1 n/a
7 TRCN0000306019 TTAAGGCACCTGAGGACAAGA pLKO_005 360 CDS 100% 4.950 3.465 N Atp5c1 n/a
8 TRCN0000076220 GTGGCTAAACAGATGAAGAAT pLKO.1 443 CDS 100% 5.625 3.375 N Atp5c1 n/a
9 TRCN0000076222 CTCCTACAAGACAGAAGAGAA pLKO.1 697 CDS 100% 4.950 2.970 N Atp5c1 n/a
10 TRCN0000076221 TCTGTATGAGAAGGCTGATAT pLKO.1 340 CDS 100% 13.200 6.600 Y Atp5c1 n/a
11 TRCN0000325622 TCTGTATGAGAAGGCTGATAT pLKO_005 340 CDS 100% 13.200 6.600 Y Atp5c1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00128 pDONR223 100% 87.1% 90.9% None (many diffs) n/a
2 TRCN0000479997 ACATTTTCTGGAAAAGGTGGAACC pLX_317 45.5% 87.1% 90.9% V5 (many diffs) n/a
3 ccsbBroadEn_05868 pDONR223 100% 87% 90.6% None (many diffs) n/a
4 ccsbBroad304_05868 pLX_304 0% 87% 90.6% V5 (many diffs) n/a
5 TRCN0000472208 TCTAAATCAGCCCGCTCTACAAAA pLX_317 38.1% 87% 90.6% V5 (many diffs) n/a
Download CSV