Transcript: Mouse XM_011248663.2

PREDICTED: Mus musculus casein kinase 1, delta (Csnk1d), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csnk1d (104318)
Length:
1748
CDS:
322..1608

Additional Resources:

NCBI RefSeq record:
XM_011248663.2
NBCI Gene record:
Csnk1d (104318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322351 ACCAAATGATAAGTCGTATTG pLKO_005 650 CDS 100% 10.800 15.120 N Csnk1d n/a
2 TRCN0000361898 CGAGAACGGAAAGTGAGTATG pLKO_005 1414 CDS 100% 10.800 15.120 N Csnk1d n/a
3 TRCN0000023772 GACCAAATGATAAGTCGTATT pLKO.1 649 CDS 100% 10.800 15.120 N Csnk1d n/a
4 TRCN0000322284 TCTATCTCGGTACGGACATTG pLKO_005 389 CDS 100% 10.800 15.120 N Csnk1d n/a
5 TRCN0000023770 GCAAGGGCTATCCTTCTGAAT pLKO.1 1043 CDS 100% 4.950 3.960 N Csnk1d n/a
6 TRCN0000322349 ATTTGCCACATACCTGAATTT pLKO_005 1062 CDS 100% 13.200 9.240 N Csnk1d n/a
7 TRCN0000322285 GGATCGAGAAGAACGATTAAG pLKO_005 1248 CDS 100% 13.200 9.240 N Csnk1d n/a
8 TRCN0000361907 TCGTATTGAGTACATTCATTC pLKO_005 663 CDS 100% 10.800 7.560 N Csnk1d n/a
9 TRCN0000023769 CCTGAATTTCTGCCGTTCCTT pLKO.1 1074 CDS 100% 3.000 2.100 N Csnk1d n/a
10 TRCN0000023773 CGGGATCGAGAAGAACGATTA pLKO.1 1246 CDS 100% 10.800 6.480 N Csnk1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487884 GTGCGCCGACGAAGTCCCGTACGG pLX_317 16.7% 85.3% 91.9% V5 (many diffs) n/a
2 ccsbBroadEn_00378 pDONR223 100% 85.2% 93.4% None (many diffs) n/a
3 ccsbBroad304_00378 pLX_304 0% 85.2% 93.4% V5 (many diffs) n/a
4 TRCN0000467149 GTTCAACACCCCCACCGCCAACGT pLX_317 16.9% 85.2% 93.4% V5 (many diffs) n/a
5 TRCN0000487781 TATCAACCTAAGCCATCACCAAAC pLX_317 17.1% 85.2% 93.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_06056 pDONR223 100% 85.1% 93.6% None (many diffs) n/a
7 ccsbBroad304_06056 pLX_304 0% 85.1% 93.6% V5 (many diffs) n/a
8 TRCN0000479473 AGTTACCGTGACGGCATGCCTGAA pLX_317 18.4% 85.1% 93.6% V5 (many diffs) n/a
9 ccsbBroadEn_14600 pDONR223 0% 85.1% 93.6% None (many diffs) n/a
10 ccsbBroad304_14600 pLX_304 0% 85.1% 93.6% V5 (many diffs) n/a
11 TRCN0000479372 TAGGCGTCATCTCCCTCATAAACC pLX_317 18.4% 85.1% 93.6% V5 (many diffs) n/a
12 TRCN0000488055 CATAGAACCCGCCGCCGAGCCGTC pLX_317 17.5% 85.1% 93.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV