Transcript: Mouse XM_006516544.3

PREDICTED: Mus musculus engulfment and cell motility 1 (Elmo1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elmo1 (140580)
Length:
3611
CDS:
154..2382

Additional Resources:

NCBI RefSeq record:
XM_006516544.3
NBCI Gene record:
Elmo1 (140580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112656 CCATCTTATACGACTCAAATT pLKO.1 2126 CDS 100% 13.200 18.480 N Elmo1 n/a
2 TRCN0000112658 TCCATCTTATACGACTCAAAT pLKO.1 2125 CDS 100% 13.200 18.480 N Elmo1 n/a
3 TRCN0000112659 CGACTCAAATTGCCAACTGAA pLKO.1 2136 CDS 100% 4.950 6.930 N Elmo1 n/a
4 TRCN0000453958 GAAATCTTAGAGCTGATTAAA pLKO_005 1825 CDS 100% 15.000 10.500 N Elmo1 n/a
5 TRCN0000450919 CACCTTCTACTTCAATCTATT pLKO_005 2557 3UTR 100% 13.200 9.240 N Elmo1 n/a
6 TRCN0000442758 GATTCCCTGCAGGACAAATTG pLKO_005 2002 CDS 100% 13.200 9.240 N Elmo1 n/a
7 TRCN0000112657 CCAAATCACAAGGTCTTACAT pLKO.1 1939 CDS 100% 5.625 3.938 N Elmo1 n/a
8 TRCN0000112655 CCTCTCATTATATCCAGCTAT pLKO.1 2667 3UTR 100% 4.950 3.465 N Elmo1 n/a
9 TRCN0000029072 GCCAGAAATCTTAGAGCTGAT pLKO.1 1821 CDS 100% 4.050 2.835 N ELMO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07496 pDONR223 100% 89% 97.5% None (many diffs) n/a
2 ccsbBroad304_07496 pLX_304 0% 89% 97.5% V5 (many diffs) n/a
3 TRCN0000467712 AATACTATAATCCGTAGTAGGAGA pLX_317 18.5% 89% 97.5% V5 (many diffs) n/a
4 ccsbBroadEn_02259 pDONR223 100% 30.9% 33.2% None (many diffs) n/a
5 ccsbBroad304_02259 pLX_304 0% 30.9% 33.2% V5 (many diffs) n/a
Download CSV