Transcript: Human NM_001331079.1

Homo sapiens spindle and centriole associated protein 1 (SPICE1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
SPICE1 (152185)
Length:
5205
CDS:
7..2616

Additional Resources:

NCBI RefSeq record:
NM_001331079.1
NBCI Gene record:
SPICE1 (152185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421011 AGGACAATTGAGGTATCTATT pLKO_005 2383 CDS 100% 13.200 18.480 N SPICE1 n/a
2 TRCN0000431281 ACTCTCAGTCTAACACGAATA pLKO_005 632 CDS 100% 10.800 15.120 N SPICE1 n/a
3 TRCN0000148466 CCGTACTATAAGCTGTGGTAT pLKO.1 4349 3UTR 100% 4.950 6.930 N SPICE1 n/a
4 TRCN0000128045 GTGACTGATCTAACCGTTCAT pLKO.1 154 CDS 100% 4.950 6.930 N SPICE1 n/a
5 TRCN0000130017 GAAAGGACATAATGACACGAA pLKO.1 2042 CDS 100% 2.640 3.696 N SPICE1 n/a
6 TRCN0000412433 GAACTGTCCTGTGATAAATAA pLKO_005 1401 CDS 100% 15.000 10.500 N SPICE1 n/a
7 TRCN0000420093 ATCCTGTGAATTAGTACTAAT pLKO_005 2722 3UTR 100% 13.200 9.240 N SPICE1 n/a
8 TRCN0000418528 CTTACCAAATAGGACTAATTC pLKO_005 1014 CDS 100% 13.200 9.240 N SPICE1 n/a
9 TRCN0000419920 GCCGTCATGAAATACACAAAT pLKO_005 200 CDS 100% 13.200 9.240 N SPICE1 n/a
10 TRCN0000427043 CTAATTTGCTTTGCATGTAAC pLKO_005 2988 3UTR 100% 10.800 7.560 N SPICE1 n/a
11 TRCN0000147177 CCCATTTGAAAGTCAGACATA pLKO.1 4682 3UTR 100% 4.950 3.465 N SPICE1 n/a
12 TRCN0000128549 GCTGAGAACAAATGAGTCATT pLKO.1 2013 CDS 100% 4.950 2.970 N SPICE1 n/a
13 TRCN0000150276 GCCCAGCTAATTTGTGTATTT pLKO.1 3563 3UTR 100% 13.200 6.600 Y SPICE1 n/a
14 TRCN0000179908 CGGTACCTTAAAGAGAGTGAA pLKO.1 1189 CDS 100% 0.000 0.000 N Spice1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05065 pDONR223 100% 98.3% 98.3% None 1_42del n/a
2 ccsbBroad304_05065 pLX_304 0% 98.3% 98.3% V5 1_42del n/a
3 TRCN0000470164 CGACGTCACAGCGTCCTCGGTTCG pLX_317 18.4% 98.3% 98.3% V5 1_42del n/a
Download CSV