Transcript: Human XM_017013979.2

PREDICTED: Homo sapiens nicotinate phosphoribosyltransferase (NAPRT), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAPRT (93100)
Length:
1744
CDS:
474..1643

Additional Resources:

NCBI RefSeq record:
XM_017013979.2
NBCI Gene record:
NAPRT (93100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242727 GCAGTGAGGTGAATGTCATTG pLKO_005 898 CDS 100% 10.800 8.640 N NAPRT n/a
2 TRCN0000180305 CCTCATCGTAGTCAGCAACAA pLKO.1 839 CDS 100% 4.950 3.960 N NAPRT n/a
3 TRCN0000242731 TTCCCTGGGTGGCGTCTATAA pLKO_005 956 CDS 100% 13.200 9.240 N NAPRT n/a
4 TRCN0000242728 CTCATGGACATGCTGCAGTTA pLKO_005 1089 CDS 100% 4.950 3.465 N NAPRT n/a
5 TRCN0000110254 CCTGCGTTCTTCGAGCACCTT pLKO.1 173 5UTR 100% 0.880 0.616 N Naprt n/a
6 TRCN0000242729 GTCAGTCCTCATCGTAGTCAG pLKO_005 833 CDS 100% 4.050 2.430 N NAPRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14345 pDONR223 100% 79.4% 72.2% None (many diffs) n/a
2 ccsbBroad304_14345 pLX_304 0% 79.4% 72.2% V5 (many diffs) n/a
3 TRCN0000474285 ACTCTCGTCCCGACTAAGGTTCTT pLX_317 47.7% 79.4% 72.2% V5 (many diffs) n/a
4 ccsbBroadEn_12989 pDONR223 100% 52.2% 48.1% None (many diffs) n/a
5 ccsbBroad304_12989 pLX_304 0% 52.2% 48.1% V5 (many diffs) n/a
6 TRCN0000470480 TGCTCCCTCGAACATTCTGATGCA pLX_317 29% 52.2% 48.1% V5 (many diffs) n/a
7 ccsbBroadEn_16068 pDONR223 0% 43.5% 43.3% None (many diffs) n/a
8 ccsbBroad304_16068 pLX_304 0% 43.5% 43.3% V5 (many diffs) n/a
Download CSV