Transcript: Human NM_017632.4

Homo sapiens CDKN2A interacting protein (CDKN2AIP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CDKN2AIP (55602)
Length:
3542
CDS:
163..1905

Additional Resources:

NCBI RefSeq record:
NM_017632.4
NBCI Gene record:
CDKN2AIP (55602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017632.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154582 GCGTTTCCTCTCAGGTAACAA pLKO.1 812 CDS 100% 5.625 7.875 N CDKN2AIP n/a
2 TRCN0000151344 GAAGATCTAGTACTCCTTGAT pLKO.1 1825 CDS 100% 4.950 6.930 N CDKN2AIP n/a
3 TRCN0000150333 CACTATTGTCTTCCAAACCTA pLKO.1 1073 CDS 100% 3.000 4.200 N CDKN2AIP n/a
4 TRCN0000155734 CAGTTGAGCAAGATCACGCAA pLKO.1 620 CDS 100% 2.640 3.696 N CDKN2AIP n/a
5 TRCN0000154885 CCTGTAAACTTACCTCCAGCA pLKO.1 1858 CDS 100% 2.160 3.024 N CDKN2AIP n/a
6 TRCN0000150843 GAAAGCAACACTGGATGTATT pLKO.1 1584 CDS 100% 13.200 9.240 N CDKN2AIP n/a
7 TRCN0000152626 GAGGTGCAAGTCTGTGTATTT pLKO.1 1677 CDS 100% 13.200 9.240 N CDKN2AIP n/a
8 TRCN0000150334 CAACAAATACATCGCTGCTAA pLKO.1 1217 CDS 100% 4.950 3.465 N CDKN2AIP n/a
9 TRCN0000154004 CTTCACACAGTAGCAGTTGTA pLKO.1 2043 3UTR 100% 4.950 3.465 N CDKN2AIP n/a
10 TRCN0000339701 GTATGGCTGAAGGCATCAAAG pLKO_005 467 CDS 100% 10.800 6.480 N Cdkn2aip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017632.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12231 pDONR223 100% 99.8% 99.8% None 722_724delCTG n/a
2 ccsbBroad304_12231 pLX_304 0% 99.8% 99.8% V5 722_724delCTG n/a
3 TRCN0000473219 CTCACAAGAGGAACCAGCTTATCC pLX_317 29.8% 99.8% 99.8% V5 722_724delCTG n/a
Download CSV