Transcript: Human NM_001323309.2

Homo sapiens zinc finger protein 454 (ZNF454), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF454 (285676)
Length:
4560
CDS:
294..803

Additional Resources:

NCBI RefSeq record:
NM_001323309.2
NBCI Gene record:
ZNF454 (285676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 706 CDS 100% 4.950 2.475 Y n/a
2 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 4146 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
3 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 4146 3UTR 100% 1.080 0.540 Y TNNI1 n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 777 CDS 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 777 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13787 pDONR223 100% 26.6% 1.7% None (many diffs) n/a
2 ccsbBroad304_13787 pLX_304 0% 26.6% 1.7% V5 (many diffs) n/a
3 TRCN0000472732 ATTTTAATGCCCTACTTTCGGATA pLX_317 100% 26.6% 1.7% V5 (many diffs) n/a
4 ccsbBroadEn_09983 pDONR223 100% 24.3% 18.3% None (many diffs) n/a
5 ccsbBroad304_09983 pLX_304 0% 24.3% 18.3% V5 (many diffs) n/a
6 TRCN0000479781 CACAGTAAACATGCCACTCCCAAT pLX_317 24.2% 24.3% 18.3% V5 (many diffs) n/a
Download CSV