Transcript: Human NM_001081442.3

Homo sapiens leukocyte immunoglobulin like receptor B5 (LILRB5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
LILRB5 (10990)
Length:
3221
CDS:
81..1856

Additional Resources:

NCBI RefSeq record:
NM_001081442.3
NBCI Gene record:
LILRB5 (10990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001081442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056871 GACGGACTTCTCACGTTTGTT pLKO.1 522 CDS 100% 5.625 7.875 N LILRB5 n/a
2 TRCN0000056872 TCTATGCAGAACCCACTCTTT pLKO.1 439 CDS 100% 4.950 6.930 N LILRB5 n/a
3 TRCN0000056870 GCATCAGATAGACACTTTCTT pLKO.1 1121 CDS 100% 5.625 4.500 N LILRB5 n/a
4 TRCN0000432030 ACCGATGCTACAGCGCAATCA pLKO_005 1258 CDS 100% 4.950 3.960 N LILRB5 n/a
5 TRCN0000056869 GCTGACATCCAGGAGGAAATT pLKO.1 1632 CDS 100% 13.200 9.240 N LILRB5 n/a
6 TRCN0000056868 GCTGTGTCTAAAGTCAAAGTA pLKO.1 1172 CDS 100% 5.625 3.938 N LILRB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14983 pDONR223 54.7% 99.6% 99.4% None (many diffs) n/a
2 ccsbBroad304_14983 pLX_304 0% 99.6% 99.4% V5 (many diffs) n/a
3 TRCN0000479724 AATACAGTCTCGATGTATTCGCGG pLX_317 36% 53.2% 52.9% V5 938A>C;944_953delTGATCGCAGG;956_1773del n/a
4 ccsbBroadEn_11582 pDONR223 100% 75% 64.8% None (many diffs) n/a
5 ccsbBroad304_11582 pLX_304 0% 75% 64.8% V5 (many diffs) n/a
6 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 75% 64.8% V5 (many diffs) n/a
Download CSV