Transcript: Human NM_001355033.2

Homo sapiens calcyphosine 2 (CAPS2), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CAPS2 (84698)
Length:
4876
CDS:
817..1965

Additional Resources:

NCBI RefSeq record:
NM_001355033.2
NBCI Gene record:
CAPS2 (84698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429071 GCAGACAACTCTTGCGATAAA pLKO_005 721 5UTR 100% 13.200 18.480 N CAPS2 n/a
2 TRCN0000053305 CACATTACTTAAACTCCGAAT pLKO.1 1284 CDS 100% 4.050 3.240 N CAPS2 n/a
3 TRCN0000434362 TTGAGTCTGCATGGCTAATTC pLKO_005 1577 CDS 100% 13.200 9.240 N CAPS2 n/a
4 TRCN0000053306 GCAAAGAAGCATTCTCAAGTA pLKO.1 1762 CDS 100% 4.950 3.465 N CAPS2 n/a
5 TRCN0000053304 GCAAGGTTGATTATGGAGAAT pLKO.1 1616 CDS 100% 4.950 3.465 N CAPS2 n/a
6 TRCN0000053303 GCAAGTCTGATGAAGTGTCAT pLKO.1 1850 CDS 100% 4.950 3.465 N CAPS2 n/a
7 TRCN0000053307 GCTTCTATGGAACAGGAGGAT pLKO.1 1345 CDS 100% 2.640 1.848 N CAPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12840 pDONR223 100% 76.6% 76.7% None 215_310del;975_1146delinsT n/a
2 ccsbBroad304_12840 pLX_304 0% 76.6% 76.7% V5 215_310del;975_1146delinsT n/a
3 TRCN0000481120 CCTCATACGGCACTATCATCACTG pLX_317 36.8% 76.6% 76.7% V5 215_310del;975_1146delinsT n/a
4 ccsbBroadEn_14312 pDONR223 100% 53.3% 53.1% None 1_534del;550G>A n/a
5 ccsbBroad304_14312 pLX_304 0% 53.3% 53.1% V5 1_534del;550G>A n/a
6 TRCN0000473503 AGCACACTTCGTAACCTGTACTCC pLX_317 76% 53.3% 53.1% V5 1_534del;550G>A n/a
Download CSV