Transcript: Human NR_104312.2

Homo sapiens COMM domain containing 4 (COMMD4), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
COMMD4 (54939)
Length:
3241
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104312.2
NBCI Gene record:
COMMD4 (54939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439235 CATGTCCCTCTCAGCAGACAA pLKO_005 546 3UTR 100% 4.950 3.465 N COMMD4 n/a
2 TRCN0000420423 CCTGCTGCAATCCGTGGAAGA pLKO_005 462 3UTR 100% 1.350 0.945 N COMMD4 n/a
3 TRCN0000143932 CCAGAACTGTGAGAAAGAAAT pLKO.1 1201 3UTR 100% 13.200 7.920 N COMMD4 n/a
4 TRCN0000438076 AGAAATCAGCACGCTGGCCAA pLKO_005 78 3UTR 100% 2.160 1.296 N COMMD4 n/a
5 TRCN0000444791 TGACGCCAAGTTTGAGTCAGG pLKO_005 195 3UTR 100% 2.160 1.296 N COMMD4 n/a
6 TRCN0000142065 GCCTCACTTCTCTCTTGAGAA pLKO.1 766 3UTR 100% 0.495 0.297 N COMMD4 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2292 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000143372 GCTGTTATGAGGAGAAGCAAA pLKO.1 350 3UTR 100% 4.950 2.475 Y COMMD4 n/a
9 TRCN0000142568 GTTTGAGTCAGGCGATGTGAA pLKO.1 204 3UTR 100% 4.950 2.475 Y COMMD4 n/a
10 TRCN0000140987 CAGTGCTGAGTTTCATCCTCT pLKO.1 236 3UTR 100% 2.640 1.320 Y COMMD4 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1828 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 918 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 918 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03489 pDONR223 100% 18.4% None 1_27del;625_3241del n/a
2 ccsbBroad304_03489 pLX_304 0% 18.4% V5 1_27del;625_3241del n/a
3 TRCN0000479852 TGGTAACCCCCCAGACACTCCAAT pLX_317 62% 18.4% V5 1_27del;625_3241del n/a
4 ccsbBroadEn_10261 pDONR223 100% 2% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 2% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2% V5 (many diffs) n/a
Download CSV