Transcript: Human XM_006714917.4

PREDICTED: Homo sapiens cyclin J like (CCNJL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNJL (79616)
Length:
3756
CDS:
732..2030

Additional Resources:

NCBI RefSeq record:
XM_006714917.4
NBCI Gene record:
CCNJL (79616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714917.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425714 CCACTTCATGGATCGCTACAA pLKO_005 926 CDS 100% 4.950 6.930 N CCNJL n/a
2 TRCN0000158409 CCTCAAGGAGTATGCCCATTA pLKO.1 1406 CDS 100% 10.800 7.560 N CCNJL n/a
3 TRCN0000156748 GTCACCCTGCAAGATCACATA pLKO.1 1437 CDS 100% 4.950 3.465 N CCNJL n/a
4 TRCN0000158129 CTGCATCCCTTAGCATGCATA pLKO.1 1909 CDS 100% 0.495 0.347 N CCNJL n/a
5 TRCN0000157639 CCTTAGCATGCATATGGCCAT pLKO.1 1916 CDS 100% 0.000 0.000 N CCNJL n/a
6 TRCN0000447152 GAGCACCTCAGCACGTGTATT pLKO_005 1575 CDS 100% 13.200 7.920 N CCNJL n/a
7 TRCN0000157225 GCAAACGGAGTTTCGCTCTTA pLKO.1 999 CDS 100% 4.950 2.970 N CCNJL n/a
8 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 1039 CDS 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714917.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12574 pDONR223 100% 84.4% 84.4% None 1_201del n/a
2 ccsbBroad304_12574 pLX_304 0% 84.4% 84.4% V5 1_201del n/a
3 TRCN0000470812 GGCTGATGGTCTAGTTTCTTTACA pLX_317 35.9% 84.4% 84.4% V5 1_201del n/a
4 ccsbBroadEn_12573 pDONR223 100% 28% 28% None 1_933del n/a
5 ccsbBroad304_12573 pLX_304 0% 28% 28% V5 1_933del n/a
6 TRCN0000473352 ATGACTCTTGTCATTTAACGATTG pLX_317 100% 28% 28% V5 1_933del n/a
Download CSV