Transcript: Human XR_002957368.1

PREDICTED: Homo sapiens RNA binding motif single stranded interacting protein 2 (RBMS2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBMS2 (5939)
Length:
8908
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957368.1
NBCI Gene record:
RBMS2 (5939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240453 CGATCCCTTGCTTTGCAAATT pLKO_005 697 3UTR 100% 13.200 18.480 N RBMS2 n/a
2 TRCN0000183067 CACAAACAAATGTAAAGGCTA pLKO.1 343 3UTR 100% 2.640 3.696 N RBMS2 n/a
3 TRCN0000148972 GATTGTTTCCACTAAGGCCAT pLKO.1 310 3UTR 100% 2.160 3.024 N RBMS2 n/a
4 TRCN0000240450 ACGTTCCTGCCCTTTACTATT pLKO_005 2019 3UTR 100% 13.200 9.240 N RBMS2 n/a
5 TRCN0000220045 CAGCAGCACAGGCACGTATAT pLKO.1 1114 3UTR 100% 13.200 9.240 N RBMS2 n/a
6 TRCN0000220046 GGTCGCAGCTTCTCATCTATA pLKO.1 2178 3UTR 100% 13.200 9.240 N RBMS2 n/a
7 TRCN0000240451 CTTTCCAGTTCAACAAGTAAC pLKO_005 1829 3UTR 100% 10.800 7.560 N RBMS2 n/a
8 TRCN0000240452 TGGATGCACCACCATTCATAC pLKO_005 983 3UTR 100% 10.800 7.560 N RBMS2 n/a
9 TRCN0000147072 CAAATGTAAAGGCTATGGCTT pLKO.1 349 3UTR 100% 2.640 1.848 N RBMS2 n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 6020 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5483 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5483 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06849 pDONR223 100% 13.6% None (many diffs) n/a
2 ccsbBroad304_06849 pLX_304 0% 13.6% V5 (many diffs) n/a
3 TRCN0000467859 TAGTCCCAGCCGATTTAAATTCGT pLX_317 25.4% 13.6% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 2.7% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 2.7% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 2.7% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 2.1% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 2.1% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2.1% V5 (many diffs) n/a
10 ccsbBroadEn_11616 pDONR223 100% 1.9% None (many diffs) n/a
11 ccsbBroad304_11616 pLX_304 0% 1.9% V5 (many diffs) n/a
12 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 1.9% V5 (many diffs) n/a
13 ccsbBroadEn_10261 pDONR223 100% .7% None (many diffs) n/a
14 ccsbBroad304_10261 pLX_304 0% .7% V5 (many diffs) n/a
15 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .7% V5 (many diffs) n/a
Download CSV