Transcript: Human XR_001743218.2

PREDICTED: Homo sapiens EPH receptor A7 (EPHA7), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA7 (2045)
Length:
7931
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743218.2
NBCI Gene record:
EPHA7 (2045)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195051 CGATGTGACCTACAGAATATT pLKO.1 1326 3UTR 100% 15.000 21.000 N EPHA7 n/a
2 TRCN0000318440 CGATGTGACCTACAGAATATT pLKO_005 1326 3UTR 100% 15.000 21.000 N EPHA7 n/a
3 TRCN0000196477 GAAACCAGTCATGATAGTAAT pLKO.1 3640 3UTR 100% 13.200 10.560 N EPHA7 n/a
4 TRCN0000318442 GAAACCAGTCATGATAGTAAT pLKO_005 3640 3UTR 100% 13.200 10.560 N EPHA7 n/a
5 TRCN0000196517 GTACTACTGCTGGATTCTAAA pLKO.1 340 3UTR 100% 13.200 10.560 N EPHA7 n/a
6 TRCN0000321888 CCTAAGTGCCACCAGAATATA pLKO_005 4678 3UTR 100% 15.000 10.500 N Epha7 n/a
7 TRCN0000196713 GAACTTGTAGTAGGCCAATAA pLKO.1 4242 3UTR 100% 13.200 9.240 N EPHA7 n/a
8 TRCN0000197070 GTCTACTTCAGCCTCCATTAA pLKO.1 1731 3UTR 100% 13.200 9.240 N EPHA7 n/a
9 TRCN0000318441 GTCTACTTCAGCCTCCATTAA pLKO_005 1731 3UTR 100% 13.200 9.240 N EPHA7 n/a
10 TRCN0000382332 AGATTTAAGAAGCACCTATAG pLKO_005 4648 3UTR 100% 10.800 7.560 N EPHA7 n/a
11 TRCN0000194873 CTTCAGTATATGCATAGAATG pLKO.1 4580 3UTR 100% 10.800 7.560 N EPHA7 n/a
12 TRCN0000006418 CGGTCATAATTGGTCTTGTTT pLKO.1 6009 3UTR 100% 5.625 3.938 N EPHA7 n/a
13 TRCN0000006421 TGGTCCATTATTGAGAACTTA pLKO.1 859 3UTR 100% 5.625 3.938 N EPHA7 n/a
14 TRCN0000349550 TGGTCCATTATTGAGAACTTA pLKO_005 859 3UTR 100% 5.625 3.938 N EPHA7 n/a
15 TRCN0000006419 GCTGGCTACAATTCCCTTGAA pLKO.1 4367 3UTR 100% 4.950 3.465 N EPHA7 n/a
16 TRCN0000006420 CCAGTGAACAGAATCCTGTTA pLKO.1 1874 3UTR 100% 0.495 0.347 N EPHA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06169 pDONR223 99.8% 37.4% None (many diffs) n/a
2 ccsbBroad304_06169 pLX_304 0% 37.4% V5 (many diffs) n/a
3 TRCN0000489864 TTAGACTCGCTATCAGCCAGGGCC pLX_317 13.7% 37.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488943 CTGGTATCGTCGGTGTGCGGGGAA pLX_317 11.9% 37.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489138 ACCCCACAATCCATATCACTCTGT pLX_317 26.9% 15.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_10803 pDONR223 100% 10.5% None (many diffs) n/a
7 ccsbBroad304_10803 pLX_304 0% 10.5% V5 (many diffs) n/a
8 TRCN0000468569 AAAGGCACATGGAGATCTATATTT pLX_317 51.8% 10.5% V5 (many diffs) n/a
Download CSV