Transcript: Human NM_032415.6

Homo sapiens caspase recruitment domain family member 11 (CARD11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
CARD11 (84433)
Length:
4354
CDS:
327..3791

Additional Resources:

NCBI RefSeq record:
NM_032415.6
NBCI Gene record:
CARD11 (84433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032415.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358793 CAGTACTCGCAGTGCTTAATC pLKO_005 1500 CDS 100% 13.200 18.480 N CARD11 n/a
2 TRCN0000107193 CGAGAACAAGTATAAGCGGAT pLKO.1 3044 CDS 100% 2.160 3.024 N CARD11 n/a
3 TRCN0000358792 GCACATGCTCAGCCGCTATAT pLKO_005 416 CDS 100% 13.200 10.560 N CARD11 n/a
4 TRCN0000107191 CGGCTGTTGGACATTCTACAT pLKO.1 549 CDS 100% 4.950 3.960 N CARD11 n/a
5 TRCN0000107194 CCTGAAGCGAACATCAGATTT pLKO.1 1871 CDS 100% 13.200 9.240 N CARD11 n/a
6 TRCN0000358739 TGCGTCAGTGTAAGGTCATTG pLKO_005 463 CDS 100% 10.800 7.560 N CARD11 n/a
7 TRCN0000107190 CCAGAGCAGCAGTTGAATGTA pLKO.1 4097 3UTR 100% 5.625 3.938 N CARD11 n/a
8 TRCN0000107192 GCTGGTCAACAGGATCTACAA pLKO.1 1280 CDS 100% 4.950 3.465 N CARD11 n/a
9 TRCN0000176395 CGACAACTACAACTTAGCCAT pLKO.1 923 CDS 100% 2.640 1.848 N Card11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032415.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467259 GCCAGATTTTCCCCACATAAGCAC pLX_317 12.4% 99.1% 99% V5 (many diffs) n/a
2 ccsbBroadEn_15196 pDONR223 47.9% 98.6% 21.7% None (many diffs) n/a
3 ccsbBroad304_15196 pLX_304 9.1% 98.6% 21.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000472351 ACTTGTGCAAACTCCCCACCCAAC pLX_317 10.3% 98.6% 21.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV