Transcript: Human NR_148402.1

Homo sapiens TRIM59-IFT80 protein (TRIM59-IFT80), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
TRIM59-IFT80 (100174949)
Length:
6117
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148402.1
NBCI Gene record:
TRIM59-IFT80 (100174949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369885 ACATTACAGGCAACCATTAAA pLKO_005 422 3UTR 100% 15.000 7.500 Y TRIM59 n/a
2 TRCN0000364838 GATGTTGGCAATCTAATTAAT pLKO_005 750 3UTR 100% 15.000 7.500 Y TRIM59 n/a
3 TRCN0000133680 GCTGGTGAAGACTGTAAATAT pLKO.1 2860 3UTR 100% 15.000 7.500 Y IFT80 n/a
4 TRCN0000369815 CAAGAAGAGTCTCCACTTAAA pLKO_005 852 3UTR 100% 13.200 6.600 Y TRIM59 n/a
5 TRCN0000364840 GACCTTCAAAGTGCCTATTTG pLKO_005 522 3UTR 100% 13.200 6.600 Y TRIM59 n/a
6 TRCN0000364903 TCCACTCAAGTGCCCTAATTG pLKO_005 281 3UTR 100% 13.200 6.600 Y TRIM59 n/a
7 TRCN0000364904 TTGCACTAAGGGCTATTATTG pLKO_005 355 3UTR 100% 13.200 6.600 Y TRIM59 n/a
8 TRCN0000137720 GCAGGCAAGCAGCTAATCATT pLKO.1 2740 3UTR 100% 5.625 2.813 Y IFT80 n/a
9 TRCN0000221017 GTGCCCTAATTGCAGAAGTAT pLKO.1 290 3UTR 100% 5.625 2.813 Y TRIM59 n/a
10 TRCN0000193055 CCAAGTTAGGAAGAGTGGAAA pLKO.1 2522 3UTR 100% 4.950 2.475 Y Ift80 n/a
11 TRCN0000345148 CCAAGTTAGGAAGAGTGGAAA pLKO_005 2522 3UTR 100% 4.950 2.475 Y Ift80 n/a
12 TRCN0000134272 GCAGTGTACTTACAAGTTGTA pLKO.1 5961 3UTR 100% 4.950 2.475 Y IFT80 n/a
13 TRCN0000221014 GCATTGAATCTTTACCTGTTA pLKO.1 331 3UTR 100% 4.950 2.475 Y TRIM59 n/a
14 TRCN0000134706 GCGCTTTATTTCATCTCCAAA pLKO.1 3447 3UTR 100% 4.950 2.475 Y IFT80 n/a
15 TRCN0000221015 GCTCTCTGTGATGTTGGCAAT pLKO.1 741 3UTR 100% 4.050 2.025 Y TRIM59 n/a
16 TRCN0000137906 GCTGTGAGACTTTGTCGCTTT pLKO.1 4054 3UTR 100% 4.050 2.025 Y IFT80 n/a
17 TRCN0000135575 GCAGCATTACTGGAATAGCAA pLKO.1 5058 3UTR 100% 3.000 1.500 Y IFT80 n/a
18 TRCN0000221018 CTGAGGTTCAACCCGTTGAAA pLKO.1 934 3UTR 100% 0.563 0.281 Y TRIM59 n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1719 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1719 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13795 pDONR223 100% 46.4% None (many diffs) n/a
2 ccsbBroad304_13795 pLX_304 0% 46.4% V5 (many diffs) n/a
3 TRCN0000472584 TCCGTTTATTTAGTTGATAAGTTG pLX_317 13.3% 46.4% V5 (many diffs) n/a
4 ccsbBroadEn_03831 pDONR223 100% 37.9% None (many diffs) n/a
5 ccsbBroad304_03831 pLX_304 0% 37.9% V5 (many diffs) n/a
6 TRCN0000465441 CCTGACTAGTTGCCCATCCCATAG pLX_317 16.1% 37.9% V5 (many diffs) n/a
7 ccsbBroadEn_05419 pDONR223 100% 17.9% None (many diffs) n/a
8 ccsbBroad304_05419 pLX_304 0% 17.9% V5 (many diffs) n/a
9 TRCN0000469426 ACGATACCACTCTATACAGACCAT pLX_317 33.3% 17.9% V5 (many diffs) n/a
Download CSV