Transcript: Human XM_011524875.3

PREDICTED: Homo sapiens ADP ribosylation factor like GTPase 17A (ARL17A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARL17A (51326)
Length:
1253
CDS:
192..803

Additional Resources:

NCBI RefSeq record:
XM_011524875.3
NBCI Gene record:
ARL17A (51326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524875.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344420 GTGTGGAGACAGTAGAATATA pLKO_005 346 CDS 100% 15.000 7.500 Y ARL17B n/a
2 TRCN0000344481 AGCAGCGGTTTCCCAAGTTTC pLKO_005 663 CDS 100% 10.800 5.400 Y ARL17B n/a
3 TRCN0000353088 CAGACCTCTGTGGCAGCATTT pLKO_005 413 CDS 100% 10.800 5.400 Y ARL17B n/a
4 TRCN0000263038 CGGATTCTTATATTGAGTTTG pLKO_005 246 CDS 100% 10.800 5.400 Y ARL17B n/a
5 TRCN0000140294 GATGTTGGCAGCCACTTCAAA pLKO.1 390 CDS 100% 5.625 2.813 Y ARL17A n/a
6 TRCN0000371106 GAATGTGGAAAGGAGGTAGAA pLKO_005 532 CDS 100% 4.950 2.475 Y ARL17B n/a
7 TRCN0000141827 GAGTTTGGATACAGCTGGAAA pLKO.1 260 CDS 100% 4.950 2.475 Y ARL17A n/a
8 TRCN0000140598 GCCAGGTAACACCAAAGCTTT pLKO.1 990 3UTR 100% 4.950 2.475 Y ARL17A n/a
9 TRCN0000371107 TGCCGTCCCTACAGTAGGTTT pLKO_005 323 CDS 100% 4.950 2.475 Y ARL17B n/a
10 TRCN0000263039 TGGTCAGCTGGACTCCATACT pLKO_005 596 CDS 100% 4.950 2.475 Y ARL17B n/a
11 TRCN0000140324 CAGTAGGTTTCTGTGTGGAGA pLKO.1 334 CDS 100% 2.640 1.320 Y ARL17A n/a
12 TRCN0000139147 CCCATCTCTTGGACAGATGAT pLKO.1 816 3UTR 100% 0.495 0.248 Y ARL17A n/a
13 TRCN0000166030 CCTCTGGAAATCAGCTGTGTT pLKO.1 698 CDS 100% 4.950 2.475 Y NBR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524875.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11975 pDONR223 100% 77.6% 77.8% None 1_51del;525_526insGTAA;528_609del n/a
2 ccsbBroad304_11975 pLX_304 0% 77.6% 77.8% V5 1_51del;525_526insGTAA;528_609del n/a
3 TRCN0000472181 ATTATGTTATCGCGATTGCCACTT pLX_317 93.6% 77.6% 77.8% V5 1_51del;525_526insGTAA;528_609del n/a
4 TRCN0000491281 ACTAATCGTCTACCCTGAGCTCTT pLX_317 73.6% 46.3% 44.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14147 pDONR223 100% 34.9% 30% None (many diffs) n/a
6 ccsbBroad304_14147 pLX_304 0% 34.9% 30% V5 (many diffs) n/a
7 TRCN0000472660 ACATCAACTGCAGGATTCTATGTG pLX_317 100% 34.9% 30% V5 (many diffs) n/a
8 ccsbBroadEn_11473 pDONR223 100% 29.5% 28.5% None (many diffs) n/a
9 ccsbBroad304_11473 pLX_304 0% 29.5% 28.5% V5 (many diffs) n/a
10 TRCN0000479820 CGTGGTACGCCAGCATATGCCAGA pLX_317 100% 29.5% 28.5% V5 (many diffs) n/a
Download CSV