Transcript: Human XM_011543927.3

PREDICTED: Homo sapiens cyclin dependent kinase 16 (CDK16), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK16 (5127)
Length:
2982
CDS:
552..2045

Additional Resources:

NCBI RefSeq record:
XM_011543927.3
NBCI Gene record:
CDK16 (5127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010250 CGAGGCATAGACAAGACCAAT pLKO.1 606 CDS 100% 4.950 6.930 N CDK16 n/a
2 TRCN0000194881 CTACACTTCATCTTCCGTATC pLKO.1 1662 CDS 100% 6.000 4.800 N CDK16 n/a
3 TRCN0000197254 GCCTATCTGAGATTGGCTTTG pLKO.1 1009 CDS 100% 6.000 4.200 N CDK16 n/a
4 TRCN0000010249 CGAGGAGTTCAAGACATACAA pLKO.1 1727 CDS 100% 5.625 3.938 N CDK16 n/a
5 TRCN0000342416 CGAGGAGTTCAAGACATACAA pLKO_005 1727 CDS 100% 5.625 3.938 N CDK16 n/a
6 TRCN0000010258 GGACCTCAAACACGCCAACAT pLKO.1 1199 CDS 100% 4.950 3.465 N CDK16 n/a
7 TRCN0000342372 GGACCTCAAACACGCCAACAT pLKO_005 1199 CDS 100% 4.950 3.465 N CDK16 n/a
8 TRCN0000010251 GACCTACATTAAGCTGGACAA pLKO.1 1040 CDS 100% 4.050 2.835 N CDK16 n/a
9 TRCN0000352623 GACCTACATTAAGCTGGACAA pLKO_005 1040 CDS 100% 4.050 2.835 N CDK16 n/a
10 TRCN0000196804 GCAATATCTCTGTATACAGAC pLKO.1 2297 3UTR 100% 4.050 2.835 N CDK16 n/a
11 TRCN0000010259 CCCAACAAAGACATACTCCAA pLKO.1 1490 CDS 100% 2.640 1.848 N CDK16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01155 pDONR223 100% 97.5% 96.8% None (many diffs) n/a
2 ccsbBroad304_01155 pLX_304 0% 97.5% 96.8% V5 (many diffs) n/a
3 TRCN0000471969 GATAATGGTTATAGACATAATCGT pLX_317 32.6% 97.5% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_06698 pDONR223 100% 97.4% 96.8% None (many diffs) n/a
5 ccsbBroad304_06698 pLX_304 0% 97.4% 96.8% V5 (many diffs) n/a
6 TRCN0000471737 CCAATCAACCGGGCCCCGAAACTC pLX_317 4.1% 97.4% 96.8% V5 (many diffs) n/a
7 ccsbBroadEn_14730 pDONR223 0% 97.4% 96.8% None (many diffs) n/a
8 ccsbBroad304_14730 pLX_304 0% 97.4% 96.8% V5 (many diffs) n/a
9 TRCN0000470260 TTAACTTACATAATTTAAGGATTG pLX_317 25.1% 97.4% 96.8% V5 (many diffs) n/a
10 TRCN0000489123 TGATCAGTTCGAGGTAGGCTTTCC pLX_317 25% 97.4% 96.8% V5 (not translated due to prior stop codon) (many diffs) n/a
11 ccsbBroadEn_11022 pDONR223 100% 87.9% 87.2% None (many diffs) n/a
12 ccsbBroad304_11022 pLX_304 0% 87.9% 87.2% V5 (many diffs) n/a
13 TRCN0000473400 TCCTTCCCTGAATCACTGGTACTA pLX_317 41.2% 87.9% 87.2% V5 (many diffs) n/a
Download CSV