Transcript: Human NM_001127500.3

Homo sapiens MET proto-oncogene, receptor tyrosine kinase (MET), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MET (4233)
Length:
6876
CDS:
397..4623

Additional Resources:

NCBI RefSeq record:
NM_001127500.3
NBCI Gene record:
MET (4233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127500.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121090 GCATGTCAACATCGCTCTAAT pLKO.1 2815 CDS 100% 13.200 18.480 N MET n/a
2 TRCN0000040045 CGCTACTTATGTGAACGTAAA pLKO.1 4509 CDS 100% 10.800 15.120 N MET n/a
3 TRCN0000121233 TCAACTTCTTTGTAGGCAATA pLKO.1 974 CDS 100% 10.800 15.120 N MET n/a
4 TRCN0000121087 GCACTATTATAGGACTTGTAT pLKO.1 4725 3UTR 100% 5.625 7.875 N MET n/a
5 TRCN0000000397 CACTGCTTTAATAGGACACTT pLKO.1 1582 CDS 100% 4.950 6.930 N MET n/a
6 TRCN0000009851 CATGTGAACGCTACTTATGTG pLKO.1 4501 CDS 100% 4.950 6.930 N MET n/a
7 TRCN0000040047 GCCAGCCTGAATGATGACATT pLKO.1 1399 CDS 100% 4.950 6.930 N MET n/a
8 TRCN0000121088 CCCTTATATGAAGTAATGCTA pLKO.1 4381 CDS 100% 3.000 4.200 N MET n/a
9 TRCN0000040046 CGAGCTAAATATAGAGTGGAA pLKO.1 3165 CDS 100% 2.640 3.696 N MET n/a
10 TRCN0000000394 CCAATTTATCAGGAGGTGTTT pLKO.1 710 CDS 100% 4.950 3.960 N MET n/a
11 TRCN0000121234 CCATAAACTCTGGATTGCATT pLKO.1 1244 CDS 100% 4.950 3.960 N MET n/a
12 TRCN0000121232 CCTGTCATATTGGAGTCCAAA pLKO.1 4855 3UTR 100% 4.950 3.960 N MET n/a
13 TRCN0000196824 GAAGTCCTCTTAACATCTATA pLKO.1 1702 CDS 100% 13.200 9.240 N MET n/a
14 TRCN0000040044 GCACGATGAATACATTGAAAT pLKO.1 2246 CDS 100% 13.200 9.240 N MET n/a
15 TRCN0000196443 GTGTGTTGTATGGTCAATAAC pLKO.1 5062 3UTR 100% 13.200 9.240 N MET n/a
16 TRCN0000196866 GACTTATTCATGGGTCAATTC pLKO.1 1678 CDS 100% 10.800 7.560 N MET n/a
17 TRCN0000196414 GATAAGGAAATGTACTGATTG pLKO.1 6260 3UTR 100% 10.800 7.560 N MET n/a
18 TRCN0000196685 GCTGTGAGAATATACACTTAC pLKO.1 3092 CDS 100% 10.800 7.560 N MET n/a
19 TRCN0000121091 CCTGACGTAAACACCTTTGAT pLKO.1 4303 CDS 100% 5.625 3.938 N MET n/a
20 TRCN0000121251 CTCATTTGGATAGGCTTGTAA pLKO.1 3383 CDS 100% 5.625 3.938 N MET n/a
21 TRCN0000121089 AGACTCATAATCCAACTGTAA pLKO.1 3965 CDS 100% 4.950 3.465 N MET n/a
22 TRCN0000000395 CAGAAGTGATTGTGGAGCATA pLKO.1 1859 CDS 100% 4.950 3.465 N MET n/a
23 TRCN0000121247 CCACACTTTGTCCAATGGTTT pLKO.1 4650 3UTR 100% 4.950 3.465 N MET n/a
24 TRCN0000199327 CCCGGATATCAGCGATCTTCT pLKO.1 4454 CDS 100% 4.950 3.465 N MET n/a
25 TRCN0000121250 CCGTGAAGATCCCATTGTCTA pLKO.1 2610 CDS 100% 4.950 3.465 N MET n/a
26 TRCN0000121248 CCTTCAGAAGGTTGCTGAGTA pLKO.1 627 CDS 100% 4.950 3.465 N MET n/a
27 TRCN0000000396 CTGTTATTACTACTTGGGTTT pLKO.1 3283 CDS 100% 4.050 2.835 N MET n/a
28 TRCN0000040043 ATCAGAACCAGAGGCTTGGTC pLKO.1 4793 3UTR 100% 2.640 1.848 N MET n/a
29 TRCN0000010379 CATCAGAACCAGAGGCTTGGT pLKO.1 4792 3UTR 100% 2.640 1.848 N MET n/a
30 TRCN0000121235 GCCACGACAAATGTGTGCGAT pLKO.1 2018 CDS 100% 2.640 1.848 N MET n/a
31 TRCN0000121249 CCACAATCATACTGCTGACAT pLKO.1 837 CDS 100% 4.950 2.970 N MET n/a
32 TRCN0000009850 CAGAATGTCATTCTACATGAG pLKO.1 553 CDS 100% 4.050 2.430 N MET n/a
33 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 5372 3UTR 100% 10.800 5.400 Y MRPS16 n/a
34 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 5372 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127500.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14696 pDONR223 0% 98.7% 98.7% None 2263_2316del n/a
2 ccsbBroad304_14696 pLX_304 15.1% 98.7% 98.7% V5 2263_2316del n/a
3 TRCN0000471392 ACGGTCGACCTTTCGGTGCTTCCT pLX_317 8.8% 98.7% 98.7% V5 2263_2316del n/a
4 TRCN0000492212 TGCCAACATGACGCCTACAAGGAA pLX_317 10.6% 98.6% 98.7% V5 (not translated due to prior stop codon) 2121T>C;2124A>G;2263_2316del n/a
5 TRCN0000489303 ACTAGCTCCGCGCACTTAACCCAA pLX_317 8.9% 98.6% 98.7% V5 (not translated due to prior stop codon) 2121T>C;2124A>G;2263_2316del n/a
6 TRCN0000488821 CATCAAGAAACTATTACTCCGATA pLX_317 7.8% 98.6% 98.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488471 GAGTTATTTCACGGACACGACAAC pLX_317 6.8% 98.6% 98.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000492123 CGGATCTTCCTACATAGGCCATCA pLX_317 28% 29.7% .1% V5 (not translated due to prior stop codon) 1_2968del n/a
Download CSV