Transcript: Human NR_026708.2

Homo sapiens C-type lectin domain family 4 member M (CLEC4M), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CLEC4M (10332)
Length:
2176
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026708.2
NBCI Gene record:
CLEC4M (10332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026708.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430212 AGACGGTTCTCTGTTCGATTT pLKO_005 1664 3UTR 100% 10.800 15.120 N CLEC4M n/a
2 TRCN0000416897 ATCCGAGCAAGACGCAATCTA pLKO_005 273 3UTR 100% 5.625 7.875 N CLEC4M n/a
3 TRCN0000029609 GAACCCAACAATAGCGGGAAT pLKO.1 1434 3UTR 100% 4.050 5.670 N CLEC4M n/a
4 TRCN0000029611 TCTATCAAGAACTGACCGATT pLKO.1 773 3UTR 100% 4.050 5.670 N CLEC4M n/a
5 TRCN0000426224 ATCGATGTGACGTTGACAATT pLKO_005 1495 3UTR 100% 13.200 10.560 N CLEC4M n/a
6 TRCN0000029613 GAATGAAGACTGTGCGGAATT pLKO.1 1451 3UTR 100% 0.000 0.000 N CLEC4M n/a
7 TRCN0000416192 GACCTGAGTGGGATGCATTTA pLKO_005 1787 3UTR 100% 13.200 9.240 N CLEC4M n/a
8 TRCN0000029612 AGCCTGCTTCAGAGACGAATA pLKO.1 1538 3UTR 100% 10.800 7.560 N CLEC4M n/a
9 TRCN0000029610 GACTTTCAATTCCAGCAGATA pLKO.1 112 3UTR 100% 4.950 3.465 N CLEC4M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026708.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07589 pDONR223 100% 47.3% None (many diffs) n/a
2 ccsbBroad304_07589 pLX_304 0% 47.3% V5 (many diffs) n/a
3 TRCN0000470248 GGGCCATAAGAAATATCGCACTAC pLX_317 43.3% 47.3% V5 (many diffs) n/a
4 ccsbBroadEn_11484 pDONR223 100% 44.4% None (many diffs) n/a
5 ccsbBroad304_11484 pLX_304 0% 44.4% V5 (many diffs) n/a
6 TRCN0000473292 TGCTTACACTGCGATGGTTGTTCT pLX_317 27.2% 44.4% V5 (many diffs) n/a
7 ccsbBroadEn_11921 pDONR223 100% 39% None (many diffs) n/a
8 ccsbBroad304_11921 pLX_304 0% 39% V5 (many diffs) n/a
9 TRCN0000470842 CGGCAAAATAGCGCGGCTCGTATT pLX_317 13.1% 39% V5 (many diffs) n/a
Download CSV