Transcript: Human NM_024779.5

Homo sapiens phosphatidylinositol-5-phosphate 4-kinase type 2 gamma (PIP4K2C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PIP4K2C (79837)
Length:
3176
CDS:
99..1364

Additional Resources:

NCBI RefSeq record:
NM_024779.5
NBCI Gene record:
PIP4K2C (79837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024779.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194793 CGTGATCGATTTGGCATTGAT pLKO.1 432 CDS 100% 5.625 7.875 N PIP4K2C n/a
2 TRCN0000199809 GCGTAGCCCACTCGATCAATG pLKO.1 259 CDS 100% 3.600 5.040 N PIP4K2C n/a
3 TRCN0000037720 CGCTTCCTTATCTCCTACGAT pLKO.1 516 CDS 100% 3.000 4.200 N PIP4K2C n/a
4 TRCN0000196425 GCCTTGATCTTTGTAATATCT pLKO.1 1642 3UTR 100% 5.625 4.500 N PIP4K2C n/a
5 TRCN0000296193 GCCTTGATCTTTGTAATATCT pLKO_005 1642 3UTR 100% 5.625 4.500 N PIP4K2C n/a
6 TRCN0000024702 CTCCAAGATCAAGGTCAACAA pLKO.1 335 CDS 100% 4.950 3.465 N Pip4k2c n/a
7 TRCN0000319779 CTCCAAGATCAAGGTCAACAA pLKO_005 335 CDS 100% 4.950 3.465 N Pip4k2c n/a
8 TRCN0000037719 GCCCAGTCATTTCAAGTTCAA pLKO.1 380 CDS 100% 4.950 3.465 N PIP4K2C n/a
9 TRCN0000289312 GCCCAGTCATTTCAAGTTCAA pLKO_005 380 CDS 100% 4.950 3.465 N PIP4K2C n/a
10 TRCN0000196354 GCCTCATTGATATCCTTACAC pLKO.1 1210 CDS 100% 4.950 3.465 N PIP4K2C n/a
11 TRCN0000310208 GCCTCATTGATATCCTTACAC pLKO_005 1210 CDS 100% 4.950 3.465 N PIP4K2C n/a
12 TRCN0000037721 GTCTACTTCATGGGCCTCATT pLKO.1 1197 CDS 100% 4.950 3.465 N PIP4K2C n/a
13 TRCN0000037723 CCTCTCCAACTATCACCAGTA pLKO.1 593 CDS 100% 4.050 2.835 N PIP4K2C n/a
14 TRCN0000199085 CCTCAAGGGTTCCCTAGTGTC pLKO.1 752 CDS 100% 1.350 0.945 N PIP4K2C n/a
15 TRCN0000296192 CCTCAAGGGTTCCCTAGTGTC pLKO_005 752 CDS 100% 1.350 0.945 N PIP4K2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024779.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15154 pDONR223 100% 98.4% 60.6% None (many diffs) n/a
2 ccsbBroad304_15154 pLX_304 0% 98.4% 60.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000466306 CTAATCTCCCGAAAGCCTCATTGA pLX_317 24.6% 98.4% 60.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488577 CAGGGATGGGGACCTGCTCTTTAT pLX_317 42% 52.6% 52.7% V5 (not translated due to prior stop codon) 1_597del;1143T>C n/a
Download CSV