Transcript: Human NM_001284400.3

Homo sapiens leucine rich repeat containing 28 (LRRC28), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LRRC28 (123355)
Length:
5692
CDS:
122..1060

Additional Resources:

NCBI RefSeq record:
NM_001284400.3
NBCI Gene record:
LRRC28 (123355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284400.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432959 ACCTCACTGTGGACCGAAATC pLKO_005 603 CDS 100% 10.800 15.120 N LRRC28 n/a
2 TRCN0000424396 ACTATACCTGCACTCAAATAA pLKO_005 328 CDS 100% 15.000 12.000 N LRRC28 n/a
3 TRCN0000423131 CCATCTTATCTGTACAATAAA pLKO_005 779 CDS 100% 15.000 10.500 N LRRC28 n/a
4 TRCN0000434516 ACCAATCGTTTGCTAACTTTA pLKO_005 548 CDS 100% 13.200 9.240 N LRRC28 n/a
5 TRCN0000425165 TTTGACCTGCTGAGTTGATAA pLKO_005 1048 CDS 100% 13.200 9.240 N LRRC28 n/a
6 TRCN0000434786 ACTCCAATGTCTGGATCTTAG pLKO_005 388 CDS 100% 10.800 7.560 N LRRC28 n/a
7 TRCN0000005130 GCTTTACGTCATCTTCGATTA pLKO.1 455 CDS 100% 10.800 7.560 N LRRC28 n/a
8 TRCN0000010924 GATAACAACATTCACCTGAAA pLKO.1 752 CDS 100% 4.950 3.465 N LRRC28 n/a
9 TRCN0000010923 CCAGTCCAGCACACTCTTCCA pLKO.1 1118 3UTR 100% 0.880 0.616 N LRRC28 n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4984 3UTR 100% 10.800 5.400 Y SMIM11A n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2280 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2280 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284400.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04772 pDONR223 100% 85% 80.4% None 870_871ins160;936_937insTGAGT n/a
2 ccsbBroad304_04772 pLX_304 0% 85% 80.4% V5 870_871ins160;936_937insTGAGT n/a
3 TRCN0000466194 TCCCGTCAACCGGTGAGCTGGTCA pLX_317 35.2% 85% 80.4% V5 870_871ins160;936_937insTGAGT n/a
4 ccsbBroadEn_13098 pDONR223 100% 26.8% 23.8% None (many diffs) n/a
5 ccsbBroad304_13098 pLX_304 0% 26.8% 23.8% V5 (many diffs) n/a
6 TRCN0000468959 TCCTAGGGACCACCATATTTTTAG pLX_317 100% 26.8% 23.8% V5 (many diffs) n/a
Download CSV