Transcript: Mouse XM_030253223.1

PREDICTED: Mus musculus heterochromatin protein 1, binding protein 3 (Hp1bp3), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Hp1bp3 (15441)
Length:
3175
CDS:
208..1755

Additional Resources:

NCBI RefSeq record:
XM_030253223.1
NBCI Gene record:
Hp1bp3 (15441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030253223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093003 GCCCTCTTCTTGTTTGTATTT pLKO.1 2750 3UTR 100% 13.200 9.240 N Hp1bp3 n/a
2 TRCN0000353731 GCCCTCTTCTTGTTTGTATTT pLKO_005 2750 3UTR 100% 13.200 9.240 N Hp1bp3 n/a
3 TRCN0000183660 CAATCTTAACTGAGGCCATTA pLKO.1 587 CDS 100% 10.800 7.560 N HP1BP3 n/a
4 TRCN0000285534 CAATCTTAACTGAGGCCATTA pLKO_005 587 CDS 100% 10.800 7.560 N HP1BP3 n/a
5 TRCN0000093005 CCTGATGGAATATGCAATCTT pLKO.1 1110 CDS 100% 5.625 3.938 N Hp1bp3 n/a
6 TRCN0000183774 CCTGATGGAATATGCAATCTT pLKO.1 1110 CDS 100% 5.625 3.938 N HP1BP3 n/a
7 TRCN0000323654 CCTGATGGAATATGCAATCTT pLKO_005 1110 CDS 100% 5.625 3.938 N Hp1bp3 n/a
8 TRCN0000093007 GAAGAAGTCTTTCAAGACAAA pLKO.1 1728 CDS 100% 4.950 3.465 N Hp1bp3 n/a
9 TRCN0000323589 GAAGAAGTCTTTCAAGACAAA pLKO_005 1728 CDS 100% 4.950 3.465 N Hp1bp3 n/a
10 TRCN0000093006 CCCAAGATGGACGCAATCTTA pLKO.1 574 CDS 100% 0.563 0.394 N Hp1bp3 n/a
11 TRCN0000323588 CCCAAGATGGACGCAATCTTA pLKO_005 574 CDS 100% 0.563 0.394 N Hp1bp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030253223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11931 pDONR223 100% 48.4% 49.2% None (many diffs) n/a
2 ccsbBroad304_11931 pLX_304 0% 48.4% 49.2% V5 (many diffs) n/a
3 TRCN0000475906 TGTTAGCCCTAACAGGCATTAGTT pLX_317 31.3% 48.4% 49.2% V5 (many diffs) n/a
4 ccsbBroadEn_11930 pDONR223 100% 13.8% 12.9% None (many diffs) n/a
5 ccsbBroad304_11930 pLX_304 0% 13.8% 12.9% V5 (many diffs) n/a
6 TRCN0000466494 ATCCCGCCTCGGCCAGTAGTTGTC pLX_317 88.7% 13.8% 12.9% V5 (many diffs) n/a
Download CSV