Transcript: Human XM_005248662.4

PREDICTED: Homo sapiens peptidase M20 domain containing 2 (PM20D2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PM20D2 (135293)
Length:
4458
CDS:
404..1156

Additional Resources:

NCBI RefSeq record:
XM_005248662.4
NBCI Gene record:
PM20D2 (135293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248662.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419803 AGCCTATGGAAAGCCTATATG pLKO_005 809 CDS 100% 13.200 18.480 N PM20D2 n/a
2 TRCN0000424221 ATCCGTACTTGATAGGATTAT pLKO_005 1339 3UTR 100% 13.200 9.240 N PM20D2 n/a
3 TRCN0000435509 CCAATATCATTCCCTCTTATT pLKO_005 630 CDS 100% 13.200 9.240 N PM20D2 n/a
4 TRCN0000421516 GAGATTTCAAACCTTATATTC pLKO_005 1538 3UTR 100% 13.200 9.240 N PM20D2 n/a
5 TRCN0000430784 TCAAGAAGAACAGTTTGTAAA pLKO_005 1123 CDS 100% 13.200 9.240 N PM20D2 n/a
6 TRCN0000413084 ATCTAATGCCTTGAATCATAC pLKO_005 958 CDS 100% 10.800 7.560 N PM20D2 n/a
7 TRCN0000148358 CCAGATATGGCTGAACATGAT pLKO.1 440 CDS 100% 4.950 3.465 N PM20D2 n/a
8 TRCN0000183794 CCCTACACAATACTAACCTTT pLKO.1 4157 3UTR 100% 4.950 3.465 N PM20D2 n/a
9 TRCN0000183458 GAAATTAAAGGTGGAGCACAT pLKO.1 761 CDS 100% 4.050 2.835 N PM20D2 n/a
10 TRCN0000149131 GTCTGTGTTCAGACAGCAAAT pLKO.1 559 CDS 100% 1.080 0.756 N PM20D2 n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1752 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2329 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2329 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248662.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04900 pDONR223 100% 57.3% 57.3% None 0_1ins558 n/a
2 ccsbBroad304_04900 pLX_304 0% 57.3% 57.3% V5 0_1ins558 n/a
3 TRCN0000476441 CGAGTAACTTCAGACTCACCGTGC pLX_317 17.2% 57.3% 57.3% V5 0_1ins558 n/a
Download CSV