Transcript: Human XM_005250861.3

PREDICTED: Homo sapiens poly(A) binding protein cytoplasmic 1 (PABPC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PABPC1 (26986)
Length:
2877
CDS:
505..2415

Additional Resources:

NCBI RefSeq record:
XM_005250861.3
NBCI Gene record:
PABPC1 (26986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293649 GGACAAATCCATTGATAATAA pLKO_005 822 CDS 100% 15.000 10.500 N PABPC1 n/a
2 TRCN0000293599 AGCTGTTCCCAACCCTGTAAT pLKO_005 1674 CDS 100% 13.200 9.240 N PABPC1 n/a
3 TRCN0000251814 TCTGGACAAATCCATTGATAA pLKO_005 819 CDS 100% 13.200 9.240 N Pabpc4l n/a
4 TRCN0000293651 GACCACCATTTAGTACTATGA pLKO_005 1883 CDS 100% 4.950 3.465 N PABPC1 n/a
5 TRCN0000054951 CGTGCTTTGGACACCATGAAT pLKO.1 703 CDS 100% 5.625 3.375 N Pabpc1 n/a
6 TRCN0000309753 CGTGCTTTGGACACCATGAAT pLKO_005 703 CDS 100% 5.625 3.375 N Pabpc1 n/a
7 TRCN0000054952 CCTAGCCAAATTGCTCAACTA pLKO.1 1777 CDS 100% 4.950 2.970 N Pabpc1 n/a
8 TRCN0000309752 CCTAGCCAAATTGCTCAACTA pLKO_005 1777 CDS 100% 4.950 2.970 N Pabpc1 n/a
9 TRCN0000074638 GCAAACATAATGCTAGTCCTA pLKO.1 2596 3UTR 100% 2.640 1.584 N PABPC1 n/a
10 TRCN0000074642 GCAAAGTATTTGTTGGACGAT pLKO.1 1001 CDS 100% 2.640 1.584 N PABPC1 n/a
11 TRCN0000074641 GCACCGTTCCACAGTATAAAT pLKO.1 2021 CDS 100% 15.000 7.500 Y PABPC1 n/a
12 TRCN0000074639 CCGCACCGTTCCACAGTATAA pLKO.1 2019 CDS 100% 13.200 6.600 Y PABPC1 n/a
13 TRCN0000298167 CCGCACCGTTCCACAGTATAA pLKO_005 2019 CDS 100% 13.200 6.600 Y PABPC1 n/a
14 TRCN0000054949 CCAAAGGATTTGGATTTGTAA pLKO.1 1193 CDS 100% 5.625 2.813 Y Pabpc1 n/a
15 TRCN0000160452 CCAAAGGATTTGGATTTGTAA pLKO.1 1193 CDS 100% 5.625 2.813 Y PABPC3 n/a
16 TRCN0000074640 CCAGACCTCATCCATTCCAAA pLKO.1 1829 CDS 100% 4.950 2.475 Y PABPC1 n/a
17 TRCN0000166200 CCAGACCTCATCCATTCCAAA pLKO.1 1829 CDS 100% 4.950 2.475 Y PABPC3 n/a
18 TRCN0000286207 CCAGACCTCATCCATTCCAAA pLKO_005 1829 CDS 100% 4.950 2.475 Y PABPC1 n/a
19 TRCN0000159954 GAAAGGAAACTTTGAACCTTA pLKO.1 2551 3UTR 100% 4.950 2.475 Y PABPC3 n/a
20 TRCN0000297494 GAAAGGAAACTTTGAACCTTA pLKO_005 2551 3UTR 100% 4.950 2.475 Y PABPC3 n/a
21 TRCN0000161364 GAACCTTATGTACCGAGCAAA pLKO.1 2564 3UTR 100% 4.950 2.475 Y PABPC3 n/a
22 TRCN0000278578 GAACCTTATGTACCGAGCAAA pLKO_005 2564 3UTR 100% 4.950 2.475 Y PABPC3 n/a
23 TRCN0000161683 GCCACTAAAGCAGTTACAGAA pLKO.1 1540 CDS 100% 4.950 2.475 Y PABPC3 n/a
24 TRCN0000278524 GCCACTAAAGCAGTTACAGAA pLKO_005 1540 CDS 100% 4.950 2.475 Y PABPC3 n/a
25 TRCN0000165156 GCGTATGTGAACTTCCAGCAT pLKO.1 667 CDS 100% 2.640 1.320 Y PABPC3 n/a
26 TRCN0000297496 GCGTATGTGAACTTCCAGCAT pLKO_005 667 CDS 100% 2.640 1.320 Y PABPC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06682 pDONR223 100% 94.4% 91.9% None (many diffs) n/a
2 ccsbBroad304_06682 pLX_304 0% 94.4% 91.9% V5 (many diffs) n/a
3 ccsbBroadEn_10408 pDONR223 100% 37.9% 32.7% None (many diffs) n/a
4 ccsbBroad304_10408 pLX_304 0% 37.9% 32.7% V5 (many diffs) n/a
Download CSV