Transcript: Human XM_005252147.4

PREDICTED: Homo sapiens spleen associated tyrosine kinase (SYK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYK (6850)
Length:
2672
CDS:
167..2074

Additional Resources:

NCBI RefSeq record:
XM_005252147.4
NBCI Gene record:
SYK (6850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252147.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197242 GCATGAGTGATGGGCTTTATT pLKO.1 264 CDS 100% 15.000 21.000 N SYK n/a
2 TRCN0000342573 GCATGAGTGATGGGCTTTATT pLKO_005 264 CDS 100% 15.000 21.000 N SYK n/a
3 TRCN0000003166 CGGGTGGAATAATCTCAAGAA pLKO.1 1023 CDS 100% 4.950 3.960 N SYK n/a
4 TRCN0000195465 CAGAGGAATTTGGCTGCTTCT pLKO.1 2525 3UTR 100% 4.050 3.240 N SYK n/a
5 TRCN0000003167 CCTTAGCATGTGACTCCTGAA pLKO.1 2491 3UTR 100% 4.050 3.240 N SYK n/a
6 TRCN0000003165 GCGCAATTACTACTATGACGT pLKO.1 2044 CDS 100% 2.640 2.112 N SYK n/a
7 TRCN0000195158 CAAATCCCTTTCATGTCTTTC pLKO.1 2361 3UTR 100% 10.800 7.560 N SYK n/a
8 TRCN0000196401 GCAGATGGTTTGTTAAGAGTT pLKO.1 908 CDS 100% 4.950 3.465 N SYK n/a
9 TRCN0000342624 GCAGATGGTTTGTTAAGAGTT pLKO_005 908 CDS 100% 4.950 3.465 N SYK n/a
10 TRCN0000197257 GCAGCAGAACAGACATGTCAA pLKO.1 1546 CDS 100% 4.950 3.465 N SYK n/a
11 TRCN0000342575 GCAGCAGAACAGACATGTCAA pLKO_005 1546 CDS 100% 4.950 3.465 N SYK n/a
12 TRCN0000199566 GCCCACAACTTGTCACCCAAA pLKO.1 2200 3UTR 100% 4.050 2.835 N SYK n/a
13 TRCN0000003164 CGACAAAGACAAGACAGGGAA pLKO.1 820 CDS 100% 2.640 1.848 N SYK n/a
14 TRCN0000003163 GCAGGCCATCATCAGTCAGAA pLKO.1 598 CDS 100% 4.950 2.970 N SYK n/a
15 TRCN0000342574 GCAGGCCATCATCAGTCAGAA pLKO_005 598 CDS 100% 4.950 2.970 N SYK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252147.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07023 pDONR223 100% 99.7% 100% None (many diffs) n/a
2 ccsbBroad304_07023 pLX_304 52.3% 63.2% 41.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14855 pDONR223 0% 99.7% 100% None (many diffs) n/a
4 TRCN0000469109 GGGACTCATCCGCCACTTACAAAG pLX_317 19.5% 99.7% 100% V5 (many diffs) n/a
5 TRCN0000487694 CAAGCTGGTCTTCCAATCGACGTG pLX_317 11.5% 99.7% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487794 GACACCTTGAAGTCTTTTATAATT pLX_317 12% 96.3% 96.3% V5 (not translated due to prior stop codon) 846_914del n/a
7 TRCN0000489533 TTATAACTTTTACCTAAAAGGTTC pLX_317 21.5% 96.3% 96.2% V5 846_914del;1905_1906insG n/a
8 ccsbBroadEn_07024 pDONR223 100% 96.3% 96.2% None 17T>A;846_914del n/a
9 ccsbBroad304_07024 pLX_304 24.8% 96.3% 96.2% V5 17T>A;846_914del n/a
10 TRCN0000473682 GATAATATGCTTGAAGTTGCAACA pLX_317 19.9% 96.3% 96.2% V5 17T>A;846_914del n/a
Download CSV