Transcript: Human XM_005252442.2

PREDICTED: Homo sapiens GATA binding protein 3 (GATA3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GATA3 (2625)
Length:
2745
CDS:
540..1874

Additional Resources:

NCBI RefSeq record:
XM_005252442.2
NBCI Gene record:
GATA3 (2625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273991 AGCCTAAACGCGATGGATATA pLKO_005 1959 3UTR 100% 13.200 18.480 N GATA3 n/a
2 TRCN0000273942 CCCAAGAACAGCTCGTTTAAC pLKO_005 1698 CDS 100% 13.200 18.480 N GATA3 n/a
3 TRCN0000019299 GCCAAGAAGTTTAAGGAATAT pLKO.1 2225 3UTR 100% 13.200 9.240 N GATA3 n/a
4 TRCN0000085478 CCCTGTAATTGTTGTTTGTAT pLKO.1 2538 3UTR 100% 5.625 3.938 N Gata3 n/a
5 TRCN0000019300 CGAGAAAGAGTGCCTCAAGTA pLKO.1 1076 CDS 100% 4.950 3.465 N GATA3 n/a
6 TRCN0000019301 CATCCAGACCAGAAACCGAAA pLKO.1 1622 CDS 100% 4.050 2.835 N GATA3 n/a
7 TRCN0000273944 CATCCAGACCAGAAACCGAAA pLKO_005 1622 CDS 100% 4.050 2.835 N GATA3 n/a
8 TRCN0000019302 CCTCTGCTTCATGGATCCCTA pLKO.1 801 CDS 100% 2.640 1.848 N GATA3 n/a
9 TRCN0000019303 CGGATGCAAGTCCAGGCCCAA pLKO.1 1280 CDS 100% 0.000 0.000 N GATA3 n/a
10 TRCN0000273989 TCTGGAGGAGGAATGCCAATG pLKO_005 1522 CDS 100% 6.000 3.600 N GATA3 n/a
11 TRCN0000285105 GTGGGCTCTACTACAAGCTTC pLKO_005 1564 CDS 100% 4.050 2.430 N GATA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06260 pDONR223 100% 99.9% 99.7% None 8T>C n/a
2 ccsbBroad304_06260 pLX_304 0% 99.9% 99.7% V5 8T>C n/a
3 TRCN0000471782 CTATGGAAGTGACGCACGTAGGCT pLX_317 35.6% 99.9% 99.7% V5 8T>C n/a
4 ccsbBroadEn_15425 pDONR223 0% 99.7% 99.7% None 777_779delAGA n/a
5 ccsbBroad304_15425 pLX_304 0% 99.7% 99.7% V5 777_779delAGA n/a
6 TRCN0000478685 GACCACTGTGATCAAGGACACGCC pLX_317 29.2% 99.7% 99.7% V5 777_779delAGA n/a
Download CSV